PCSK6 Clone

Catalog Number: CSB-CL017645HU2-CSB

Manufacturer:
Cusabio Biotech
Physical state: Liquid
Type: Clone
Target: Human
Shipping Condition: Blue Ice
Target sequence: ATGCCTCCGCGCGCGCCGCCTGCGCCCGGGCCCCGGCCGCCGCCCCGGGCCGCCGCCGCCACCGACACCGCCGCGGGCGCGGGGGGCGCGGGGGGCGCGGGGGGCGCCGGCGGGCCCGGGTTCCGGCCGCTCGCGCCGCGTCCCTGGCGCTGGCTGCTGCTGCTGGCGCTGCCTGCCGCCTGCTCCGCGCCCCCGCCGCGCCCCGTCTACACCAACCACTGGGCGGTGCAAGTGCTGGGCGGCCCGGCCGAGGCGGACCGCGTGGCGGCGGCGCACGGGTACCTCAACTTGGGCCAGATTGGAAACCTGGAAGATTACTACCATTTTTATCACAGCAAAACCTTTAAAAGATCAACCTTGAGTAGCAGAGGCCCTCACACCTTCCTCAGAATGGACCCCCAGGTGAAATGGCTCCAGCAACAGGAAGTGAAACGAAGGGTGAAGAGACAGGTGCGAAGTGACCCGCAGGCCCTTTACTTCAACGACCCCATTTGGTCCAACATGTGGTACCTGCATTGTGGCGACAAGAACAGTCGCTGCCGGTCGGAAATGAATGTCCAGGCAGCGTGGAAGAGGGGCTACACAGGAAAAAACGTGGTGGTCACCATCCTTGATGATGGCATAGAGAGAAATCACCCTGACCTGGCCCCAAATTATGATTCCTACGCCAGCTACGACGTGAACGGCAATGATTATGACCCATCTCCACGATATGATGCCAGCAATGAAAATAAACACGGCACTCGTTGTGCGGGAGAAGTTGCTGCTTCAGCAAACAATTCCTACTGCATCGTGGGCATAGCGTACAATGCCAAAATAGGAGGCATCCGCATGCTGGACGGCGATGTCACAGATGTGGTCGAGGCAAAGTCGCTGGGCATCAGACCCAACTACATCGACATTTACAGTGCCAGCTGGGGGCCGGACGACGACGGCAAGACGGTGGACGGGCCCGGCCGACTGGCTAAGCAGGCTTTCGAGTATGGCATTAAAAAGGGCCGGCAGGGCCTGGGCTCCATTTTCGTCTGGGCATCTGGGAATGGCGGGAGAGAGGGGGACTACTGCTCGTGCGATGGCTACACCAACAGCATCTACACCATCTCCGTCAGCAGCGCCACCGAGAATGGCTACAAGCCCTGGTACCTGGAAGAGTGTGCCTCCACCCTGGCCACCACCTACAGCAGTGGGGCCTTTTATGAGCGAAAAATCGTCACCACGGATCTGCGTCAGCGCTGTACCGATGGCCACACTGGGACCTCAGTCTCTGCCCCCATGGTGGCGGGCATCATCGCCTTGGCTCTAGAAGCAAACAGCCAGTTAACCTGGAGGGACGTCCAGCACCTGCTAGTGAAGACATCCCGGCCGGCCCACCTGAAAGCGAGCGACTGGAAAGTGAACGGCGCGGGTCATAAAGTTAGCCATTTCTATGGATTTGGTTTGGTGGACGCAGAAGCTCTCGTTGTGGAGGCAAAGAAGTGGACAGCAGTGCCATCGCAGCACATGTGTGTGGCCGCCTCGGACAAGAGACCCAGGAGCATCCCCTTAGTGCAGGTGCTGCGGACTACGGCCCTGACCAGCGCCTGCGCGGAGCACTCGGACCAGCGGGTGGTCTACTTGGAGCACGTGGTGGTTCGCACCTCCATCTCACACCCACGCCGAGGAGACCTCCAGATCTACCTGGTTTCTCCCTCGGGAACCAAGTCTCAACTTCTGGCAAAGAGGTTGCTGGATCTTTCCAATGAAGGGTTTACAAACTGGGAATTCATGACTGTCCACTGCTGGGGAGAAAAGGCTGAAGGGCAGTGGACCTTGGAAATCCAAGATCTGCCATCCCAGGTCCGCAACCCGGAGAAGCAAGGGAAGTTGAAAGAATGGAGCCTCATACTGTATGGCACAGCAGAGCACCCGTACCACACCTTCAGTGCCCATCAGTCCCGCTCGCGGATGCTGGAGCTCTCAGCCCCAGAGCTGGAGCCACCCAAGGCTGCCCTGTCACCCTCCCAGGTGGAAGTTCCTGAAGATGAGGAAGATTACACAGGTGTGTGCCATCCGGAGTGTGGTGACAAAGGCTGTGATGGCCCCAATGCAGACCAGTGCTTGAACTGCGTCCACTTCAGCCTGGGGAGTGTCAAGACCAGCAGGAAGTGCGTGAGTGTGTGCCCCTTGGGCTACTTTGGGGACACAGCAGCAAGACGCTGTCGCCGGTGCCACAAGGGGTGTGAGACCTGCTCCAGCAGAGCTGCGACGCAGTGCCTGTCTTGCCGCCGCGGGTTCTATCACCACCAGGAGATGAACACCTGTGTGACCCTCTGTCCTGCAGGATTTTATGCTGATGAAAGTCAGAAAAATTGCCTTAAATGCCACCCAAGCTGTAAAAAGTGCGTGGATGAACCTGAGAAATGTACTGTCTGTAAAGAAGGATTCAGCCTTGCACGGGGCAGCTGCATTCCTGACTGTGAGCCAGGCACCTACTTTGACTCAGAGCTGATCAGATGTGGGGAATGCCATCACACCTGCGGAACCTGCGTGGGGCCAGGCAGAGAAGAGTGCATTCACTGTGCGAAAAACTTCCACTTCCACGACTGGAAGTGTGTGCCAGCCTGTGGTGAGGGCTTCTACCCAGAAGAGATGCCGGGCTTGCCCCACAAAGTGTGTCGAAGGTGTGACGAGAACTGCTTGAGCTGTGCAGGCTCCAGCAGGAACTGTAGCAGGTGTAAGACGGGCTTCACACAGCTGGGGACCTCCTGCATCACCAACCACACGTGCAGCAACGCTGACGAGACATTCTGCGAGATGGTGAAGTCCAACCGGCTGTGCGAACGGAAGCTCTTCATTCAGTTCTGCTGCCGCACGTGCCTCCTGGCCGGGTAA

Select unit and size:

Quantity: