EpiDyne® Nucleosome Remodeling Assay Substrate ST601-GATC1

Catalogue Number: 16-4101-EPC

Manufacturer:EpiCypher
Shelf Life:6 months
Type:DNA Binding Proteins
Shipping Condition:Dry Ice
Unit(s): 50 ug

Description

Description: Mononucleosomes assembled from recombinant human histones expressed in E. coli (two each of histones H2A, H2B, H3 and H4. Accession numbers: H2A-P04908; H2B-O60814; H3.1-P68431; H4-P62805) wrapped by provided 217 base pair DNA sequence that includes the 601 sequence with and added GATC.

Additional Text

Application Notes

This product is a control for nucleosome sliding assays using DpnII to determine accessibility of GATC. DNA Sequence: CTAGGAATTCATCAGAATCCCGGTGCCGAGGCCGATCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCGATGATGATGGATAGATGGATGATGGATGGATGGATGATGATGGATGAATAGATGGATGGATGAAGCTTTAGG