EpiDyne Remodeling Assay Substrate DNA ST601-GATC1

Catalogue Number: 18-4101-EPC

Manufacturer:EpiCypher
Shelf Life:24 months
Type:Substrate
Shipping Condition:Blue Ice
Unit(s): 50 ug

Description

Description: EpiDyne Remodeling Assay Substrate DNA ST601-GATC1 is a 217 base-pair double-stranded DNA fragment. This sequence includes the Lowary 601 nucleosome positioning sequence (see 18-0005) as well as a 3' acceptor sequence to accomodate the histone octamer subsequent to remodeling. ST601-GATC1 DNA has a restriction enzyme site embedded in the 601 sequence that is accessible after nucleosome remodeling.

Additional Text

Application Notes

EpiDyne Remodeling Assay Substrate DNA ST601-GATC0 is useful as a positive control for restriction enzyme accessibility nucleosome remodeling assays using the EpiDyne Remodeling Assay Substrate, as a DpnII (GATC in red) and the naturally occurring MfeI (AATTGG in blue) restriction enzyme site are present within the 601 sequence. DNA Sequence: GAATTCATCAGAATCCCGGTGCCGAGGCCGATCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCGATGATGATGGATAGATGGATGATGGATGGATGGATGATGATGGATGAATAGATGGATGGATGAAGCTT