Anti-ssDNA/dsDNA [m3D8]
Catalogue Number: AB00347-1.6-BT-ABA
| Manufacturer: | Vector Laboratories, Inc (ABA) |
| Type: | Recombinant Monoclonal |
| Alias: | single-/double-strand DNA; desoxyribonucleic acid; dsDNA; ssDNA |
| Shipping Condition: | Blue Ice |
| Unit(s): | 1 mg |
| Host name: | Mouse |
| Clone: | m3D8 |
| Isotype: | |
| Immunogen: | 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC |
| Application: | ELISA, SPR |
Additional Text
Purification
Purified
Antibody Clonality
Recombinant Monoclonal
Storage Note
Store at 4⁰C for up to 3 months. Note, this antibody is provided without added preservatives, it is therefore recommed this antibody be handled under sterile conditions. For longer storage, aliquot and store at -20⁰C.
Application Notes
This catalytic antibody binds to DNA oligomers both single- and double-stranded, irrespective of the sequence, showing DNA-hydrolytic activity. DNA is the principle storage of genetic information and usually sequestered within the nucleus in Eukaryotes. Extracellular DNA is a key danger signal for the immune system and an antigen to disease-causing auto-antibodies (incl. DNA-hydrolysing antibodies) e.g. in Systemic Lupus Erythematosus. Antibody formats comprising different numbers of variable domains may be useful tools in investigating the significance of these catalytic antibodies in disease.
AB00347-1.6-BT Datasheet
SUPPORT
outstanding technical support
PRODUCT
we offer a full product guarantee
DELIVERY
we offer free delivery to UK universities and non profit organisations