Anti-ssDNA/dsDNA [m3D8]

Catalogue Number: AB00347-1.7-ABA

Manufacturer:Vector Laboratories, Inc (ABA)
Type:Recombinant Monoclonal
Alias:single-/double-strand DNA; desoxyribonucleic acid; dsDNA; ssDNA
Shipping Condition:Blue Ice
Unit(s): 200 ug
Host name: Mouse
Clone: m3D8
Isotype:
Immunogen: 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
Application: ELISA, SPR

Additional Text

Purification

Purified

Antibody Clonality

Recombinant Monoclonal

Storage Note

Store at 4⁰C for up to 3 months. For longer storage, aliquot and store at -20⁰C.

Application Notes

This catalytic antibody binds to DNA oligomers both single- and double-stranded, irrespective of the sequence, showing DNA-hydrolytic activity. DNA is the principle storage of genetic information and usually sequestered within the nucleus in Eukaryotes. Extracellular DNA is a key danger signal for the immune system and an antigen to disease-causing auto-antibodies (incl. DNA-hydrolysing antibodies) e.g. in Systemic Lupus Erythematosus. Antibody formats comprising different numbers of variable domains may be useful tools in investigating the significance of these catalytic antibodies in disease.