Anti-ssDNA/dsDNA [m3D8]
Catalogue Number: AB00347-10.0-ABA
| Manufacturer: | Vector Laboratories, Inc (ABA) |
| Type: | Recombinant Monoclonal |
| Alias: | single-/double-strand DNA; desoxyribonucleic acid; dsDNA; ssDNA |
| Shipping Condition: | Blue Ice |
| Unit(s): | 100 ug |
| Host name: | Human |
| Clone: | m3D8 |
| Isotype: | IgG1 |
| Immunogen: | 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC |
| Application: | ELISA, SPR |
Additional Text
Purification
Purified
Antibody Clonality
Recombinant Monoclonal
Storage Note
Store at 4⁰C for up to 3 months. For longer storage, aliquot and store at -20⁰C.
Application Notes
This catalytic antibody binds to DNA oligomers both single- and double-stranded, irrespective of the sequence, showing DNA-hydrolytic activity. DNA is the principle storage of genetic information and usually sequestered within the nucleus in Eukaryotes. Extracellular DNA is a key danger signal for the immune system and an antigen to disease-causing auto-antibodies (incl. DNA-hydrolysing antibodies) e.g. in Systemic Lupus Erythematosus. Antibody formats comprising different numbers of variable domains may be useful tools in investigating the significance of these catalytic antibodies in disease.
Short Description
This chimeric human antibody was made using the variable domain sequences of the original Mouse IgG1 format, for improved compatibility with existing reagents, assays and techniques.
AB00347-10.0 Datasheet
SUPPORT
outstanding technical support
PRODUCT
we offer a full product guarantee
DELIVERY
we offer free delivery to UK universities and non profit organisations