Anti-ssDNA/dsDNA [m3D8]

Catalogue Number: AB00347-10.0-BT-ABA

Manufacturer:Vector Laboratories, Inc (ABA)
Type:Recombinant Monoclonal
Alias:single-/double-strand DNA; desoxyribonucleic acid; dsDNA; ssDNA
Shipping Condition:Blue Ice
Unit(s): 1 mg
Host name: Human
Clone: m3D8
Isotype: IgG1
Immunogen: 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
Application: ELISA, SPR

Additional Text

Purification

Purified

Antibody Clonality

Recombinant Monoclonal

Storage Note

Store at 4⁰C for up to 3 months. Note, this antibody is provided without added preservatives, it is therefore recommed this antibody be handled under sterile conditions. For longer storage, aliquot and store at -20⁰C.

Application Notes

This catalytic antibody binds to DNA oligomers both single- and double-stranded, irrespective of the sequence, showing DNA-hydrolytic activity. DNA is the principle storage of genetic information and usually sequestered within the nucleus in Eukaryotes. Extracellular DNA is a key danger signal for the immune system and an antigen to disease-causing auto-antibodies (incl. DNA-hydrolysing antibodies) e.g. in Systemic Lupus Erythematosus. Antibody formats comprising different numbers of variable domains may be useful tools in investigating the significance of these catalytic antibodies in disease.

Short Description

This chimeric human antibody was made using the variable domain sequences of the original Mouse IgG1 format, for improved compatibility with existing reagents, assays and techniques.