Rhesus C20H16orf45 Gene ORF cDNA clone expression plasmid, N-Flag tag

Catalogue Number: CG90430-NF-SIB

Manufacturer:Sino Biological
Shelf Life:3 months
Type:Vector
Alias:C20H16orf45
Shipping Condition:RT
Unit(s): 1 Unit

Additional Text

Antibiotic Resistance

Kanamycin

cDNA Size

615 bp

Promotor

Enhanced CMV mammalian cell promoter

Short Description

Full length Clone DNA of Macaca mulatta (Rhesus monkey) chromosome 16 open reading frame 45 with N terminal Flag tag.

Tag

FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG

Vector Type

pCMV3-N-FLAG

Protein: TAG

FLAG™ Tag