Cynomolgus RANGAP1 Gene ORF cDNA clone expression plasmid, N-Flag tag

Catalogue Number: CG90431-NF-SIB

Manufacturer:Sino Biological
Shelf Life:3 months
Type:Vector
Alias:RANGAP1
Shipping Condition:RT
Unit(s): 1 Unit

Additional Text

Antibiotic Resistance

Kanamycin

cDNA Size

1761 bp

Promotor

Enhanced CMV mammalian cell promoter

Short Description

Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) Ran GTPase activating protein 1 with N terminal Flag tag.

Tag

FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG

Vector Type

pCMV3-N-FLAG

Protein: TAG

FLAG™ Tag