Rhesus APEX1/APE1/Ref-1 Gene ORF cDNA clone expression plasmid, N-Flag tag

Catalogue Number: CG90434-NF-SIB

Manufacturer:Sino Biological
Shelf Life:3 months
Type:Vector
Alias:APEX1
Shipping Condition:RT
Unit(s): 1 Unit

Additional Text

Antibiotic Resistance

Kanamycin

cDNA Size

957 bp

Promotor

Enhanced CMV mammalian cell promoter

Short Description

Full length Clone DNA of Macaca mulatta (Rhesus monkey) APEX nuclease (multifunctional DNA repair enzyme) 1 with N terminal Flag tag.

Tag

FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG

Vector Type

pCMV3-N-FLAG

Protein: TAG

FLAG™ Tag