Rhesus RRAGA Gene ORF cDNA clone expression plasmid, N-Flag tag

Catalogue Number: CG90435-NF-SIB

Manufacturer:Sino Biological
Shelf Life:3 months
Type:Vector
Alias:RRAGA
Shipping Condition:RT
Unit(s): 1 Unit

Additional Text

Antibiotic Resistance

Kanamycin

cDNA Size

942 bp

Promotor

Enhanced CMV mammalian cell promoter

Short Description

Full length Clone DNA of Macaca mulatta (Rhesus monkey) Ras-related GTP binding A with N terminal Flag tag.

Tag

FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG

Vector Type

pCMV3-N-FLAG

Protein: TAG

FLAG™ Tag