Oligo Substrates: DNMT Substrate-1
Catalogue Number: D53-58-SCB
| Manufacturer: | SinoBiological SCB |
| Molecular Weight: | The size of double-stranded oligonucleotide is 34 base pairs. The molecular weight is 20891.54. |
| Type: | Substrate |
| Alias: | NM_000284 |
| Shipping Condition: | Blue Ice |
| Unit(s): | 105 ug |
| Application: | EnzyAct |
Additional Text
Accession Number
NM_000284
Short Description
The synthetic double-stranded oligonucleotide (Sense: 5'- GATCCGACGACGACGCGCGCGCGACGACGAGATC; Anti-sense: 5'- GATCTCGTCGTCGCGCGCGCGTCGTCGTCGGAC) is used as a substrate for DNA methyltransferase 3A (DNMT3A).
D53-58 Datasheet
SUPPORT
outstanding technical support
PRODUCT
we offer a full product guarantee
DELIVERY
we offer free delivery to UK universities and non profit organisations