Methylated cytosine DNA standard kit

Catalogue Number: GTX400004-GTX

Manufacturer:GeneTex
Preservative:no Preservative|No Preservative
Physical state:Lyophilized
Type:Standards
Alias:5-methylcytosine , 5-hydroxymethylcytosine , 5-formylcytosine , 5-carboxylcytosine
Shipping Condition:Blue Ice
Unit(s): 1 kit
Application: DB

Additional Text

Note

For In vitro laboratory use only. Not for any clinical, therapeutic, or diagnostic use in humans or animals. Not for animal or human consumption

Short Description

The Methylated cytosine DNA standard kit is a set of five DNA standards that are linear dsDNA, 426 bp, and have the same sequence (see sequence below & figure). The only difference is that each contains either normal cytosines, 5-methylcytosines, 5-hydroxymethylcytosines, 5-formylcytosines, or 5-carboxylcytosines. Since the sequence and extent of cytosine modification is known, this DNA standard set is ideal for use in calibration of various applications intended for quantitation of cytosine modifications. Sequence Information: 5'CGGGGTACCTTCACTTCAGAATCAACCAAACAGCCAAAACTGTTACATCAGGTTGTGGA GCAGTTACAAAAGGTTCATTTTATCACAGATACCCTGTCAAAGGGTGAGACAAAGTTCATG GGTGTTTGCCAGCTTCCCAGTAAAAATGATGAAAAAGAATATCCACACAGAAGAATTGATA TCAGGTTGATACCCAAAGATCAGTATTACTGTGGTGTTCTCTATTTCACTGGGAGTGATAT TTTCAATAAGAATATGAGGGCTCATGCCCTAGAAAAGGGTTTCACAATCAATGAGTACACC ATCCGTCCCTTGGGAGTCACTGGAGTTGCAGGAGAACCCCTGCCAGTGGATAGTGAAAAA GACATCTTTGATTACATCCAGTGGAAATACCGGGAACCCAAGGACCGGAGCGAAGAATTC CCG 3' Note: Sequence is same for all five standards. Depending on the DNA, all C's are unmodified cytosine, 5-methylcytosine, 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

Storage Note

Store at 4C or below. After reconstitution, aliquot immediately and store at -20C or below. Avoid multiple freeze-thaw cycles.