Cusabio Biotech Co Ltd are a top quality manufacturer of Elisa kits and immunological reagents.

They provide products and services to academic and government research institutes, biotechnology and pharmaceutical companies.


Product Categories

CUSABIO BIOTECH CO., Ltd. is a biotech company that manufactures and sells the highest quality research, reagents and instruments. In collaboration with top level business partners in the fields of molecular biology, immunology, cell biology and IVD.

They provide products and services to a broad range of customers worldwide–from academic and government research institutions; biotechnology and pharmaceutical companies; as well as hospitals, reference laboratories. In the past development, CUSABIO BIOTECH CO., Ltd. has formed an extensive Sales and Marketing management network system serving the Life Science researchers and Healthcare professionals.

The main products of CUSABIO BIOTECH CO., Ltd. are ELISA kits & relative products and other immunological reagents, such as antibodies. Their main clients are professor, researcher, and experts from University, Hospital, and Research Institution. Their sales strategy is active sales, internet and by phone.

For expanding China market and reducing production costs, in August, 2008 CUSABIO BIOTECH CO., Ltd. purchased WUHAN HUAMEI BIOTECH CO., Ltd., which became a wholly owned subsidiary. WUHAN HUAMEI BIOTECH CO., Ltd. is located in Wuhan, P.R. China and consists of a products and sales force which provides products for development of biotechnology in China. CUSABIO BIOTECH CO., Ltd. will become an R & D Center of Life Science.

Their modern logistics system insures that goods will be delivered in a timely manner due to today’s electronic commerce and e-supply. Consequently, this will promote a constant upgrading of customer satisfaction in the booming global market.

 

cusabio-biotech-co

Hot Categories

Animal Free Cytokines refer to a series of cytokines without animal component. CUSABIO has provided many cytokines covered most of factors commonly used in cell culture.

Why Choose Us?

 Animal Free

  • Without animal-derived pathogens in the culture system, it is the best choice to clinical cell culture.
  • Without xenogeneic rejection and allergic reactions, it is more suitable for in vivo experiments.
  • Without the interference of animal proteins and hormones, the experimental results can be more stable and reliable.

 Low Endotoxin

  • Endotoxin Level < 0.1 EU/μg
  • Endotoxin levels as low as 0.01 EU/μg for customers with special needs

 High Activity

Recombinant Human GM-CSF (CSB-AP002081HU)

Blue Curve CUSABIO Recombinant Human GM-CSF, ED50=0.0175 ng/mL
Red Curve xx Company Recombinant Human GM-CSF, ED50=0.0244 ng/mL

Recombinant Human TNF-alpha (CSB-AP005891HU)

Red Curve CUSABIO Recombinant Human TNF-alpha, ED50=0.096 ng/mL
Green Curve xx Company Recombinant Human TNF-alpha, ED50=0.26 ng/mL

High Purity

Recombinant Human GM-CSF (CSB-AP002081HU)

Recombinant Human IL-4 (CSB-AP005831HU)

Good Stability

Recombinant Human IL-4 (CSB-AP001691HU)

Part of CUSABIO Cytokines in Cell Culture

 CIK (Cytokine-induced Killer Cell)

Target Code Source Tag Info
Human Flt-3 Ligand CSB-AP005901HU E.Coli Tag-Free
Human IFN-γ CSB-AP004201HU E.Coli Tag-Free
Human IL-15 CSB-AP005861HU E.Coli Tag-Free
Human IL-1α CSB-AP005801HU E.Coli Tag-Free
Human IL-2 CSB-AP005811HU E.Coli Tag-Free
Human IL-21 CSB-AP005871HU E.Coli Tag-Free
Human IL-7 CSB-AP005851HU E.Coli Tag-Free
Human SCF CSB-AP002061HU E.Coli Tag-Free

 

DC (Dendritic Cell)

Target Code Source Tag Info
Human CD40 Ligand CSB-AP002211HU E.Coli Tag-Free
Human GM-CSF CSB-AP002081HU E.Coli Tag-Free
Human IL-4 CSB-AP005831HU E.Coli Tag-Free
Human TNF-α CSB-AP005891HU E.Coli Tag-Free

 

CAR-T (Chimeric Antigen Receptor T Cell)

Target Code Source Tag Info
Human IL-7 CSB-AP005851HU E.Coli Tag-Free
Human IL-2 CSB-AP005811HU E.Coli Tag-Free
Human IL-15 CSB-AP005861HU E.Coli Tag-Free

 

NSC (Neural Stem Cell)

Target Code Source Tag Info
Human bFGF CSB-AP005911HU E.Coli Tag-Free
Human CNTF CSB-AP002841HU E.Coli Tag-Free
Human FGF-8 CSB-AP004031HU E.Coli Tag-Free
Human GDNF CSB-AP002881HU E.Coli Tag-Free
Human BMP-2 CSB-AP002981HU E.Coli Tag-Free
Human EGF CSB-AP005931HU E.Coli Tag-Free
Human β-NGF CSB-AP003771HU E.Coli Tag-Free
Human Galectin-1 CSB-AP000471HU E.Coli Tag-Free

 

HSC (Hematopoietic Stem Cell)

Target Code Source Tag Info
Human Flt-3 Ligand CSB-AP005901HU E.Coli Tag-Free
Human GM-CSF CSB-AP002081HU E.Coli Tag-Free
Human IL-3 CSB-AP005821HU E.Coli Tag-Free
Human IL-6 CSB-AP005841HU E.Coli Tag-Free
Human SCF CSB-AP002061HU E.Coli Tag-Free
Human Shh CSB-AP000371HU E.Coli Tag-Free
Human TPO CSB-AP003971HU E.Coli Tag-Free
Human VEGF CSB-AP002591HU E.Coli Tag-Free

 

ESC (Embryonic Stem Cell)

Target Code Source Tag Info
Human Activin A CSB-AP005361HU Mammalian cell C-terminal 6xHis-tagged
Human BAFF CSB-AP002191HU E.Coli Tag-Free
Human bFGF CSB-AP005911HU E.Coli Tag-Free
Human TGF-β1 CSB-AP003861HU Mammalian cell Tag-Free
Human FGF-4 CSB-AP002411HU E.Coli Tag-Free
Human IGF-1 CSB-AP005921HU E.Coli Tag-Free
Human Noggin CSB-AP003011HU E.Coli Tag-Free

Transmembrane protein series three: G protein-Coupled Receptor

What is G protein-Coupled Receptor?

Transmembrane proteins (TP) is a type of membrane protein that spans one side of the membrane to the other. Transmembrane proteins perform many important cellular biological functions in the body. It is involved in the exchange of matter, energy and signals inside and outside the cell membrane. For example, transmembrane proteins can be receptors for a variety of signaling molecules, hormones, and other substrates, and can activate intra-membrane signaling pathways.

G protein-coupled receptor (GPCR) is a class of transmembrane proteins that detect extracellular molecules and activate internal signal transduction pathways that ultimately activate cellular responses.

G protein-coupled receptors are also known as seven alpha-helices transmembrane segment receptors (7TM receptors). They mediate signals involving visual control, renal function, tumorigenesis, immune response, and inflammation.

Classification of G protein-Coupled Receptor (GPCR)

GPCRs can be divided into six categories based on sequence homology:

Class A: Rhodopsin-like receptor
Class B: Secretin receptor family
Class C: Metabolic glutamate receptor
Class D: Fungal mating pheromone receptor
Class E: Cyclic adenosine receptor
Class F: Frizzled/Smoothened family

Class A accounts for nearly 85% of the GPCR gene and is currently the largest.

In a new classification system, namely GRAFS classification system, GPCR is divided into five categories: glutamate, Rhodopsin, Adhesion, Frizzled/Taste2, Secretin).

G protein-Coupled Receptor (GPCR) ligand

The ligand binds to the G-protein-coupled receptor, activates the G-protein, and transmits the signal to the cell, eventually activating the cell reaction. More than 100 ligands are known to achieve transmembrane signaling through G-protein coupled receptors, including: Biogenic amines (epinephrine, norepinephrine, histamine, 5-hydroxytryptamine); Peptide hormones (bradykinin, luteinizing hormone, parathyroid hormone); Odor molecules; photons.

Physiological effects of G protein-Coupled Receptor (GPCR)

Vision: Photosensitive G-protein coupled receptor rhodopsin can converts electromagnetic radiation into cellular signals and initiates downstream signaling processes.

Taste: GPCRs can mediate the release of bitter, umami and sweet substances by gustducin.

Olfactory: Olfactory epithelium in the nasal cavity and olfactory receptors on the vomeronasal can sense odor molecules and pheromones.

Physiological effects of GPCRs also include: behavioral and mood regulation; regulation of the immune system; regulation of the autonomic nervous system; detection and regulation of cell density.

G protein-Coupled Receptor (GPCR)and drug development

Major human diseases such as cancer, AIDS, heart disease, diabetes, Alzheimer’s disease, Parkinson’s disease, dwarfism, dwarfism, color blindness, retinitis pigmentosa and asthma are closely related to GPCRs. Therefore, GPCR is also a “star” in the field of drug development.

Currently, about 40% of marketed drugs are designed based on GPCRs. At least one-third of small molecule drugs in the world’s pharmaceutical market are currently activators or antagonists of GPCRs. Twenty percent of the top 50 best-selling drugs currently on the market are reportedly G-receptor-related drugs.

For more details about GPCRs, for example, the structure, history, etc., please read the article: G protein-Coupled Receptor – Targets for Drug Therapy.

The important role of GPCR in the drug target protein determines its importance in the life sciences. CUSABIO can provide the products you need for your research. Currently, we could product 183 GPCR-related products: 70 protein products, 89 antibody products, 24 ELISA products.

Hot Products

Recombinant Human Atypical chemokine receptor 2(ACKR2) (CSB-CF004618HU)

Recombinant Human C-C chemokine receptor type 2(CCR2) (CSB-CF004841HU)

G protein-Coupled Receptor (GPCR) related proteins for your research

Target Product Name Code Expression System
ACKR1 Recombinant Human Atypical chemokine receptor 1(ACKR1) CSB-CF624105HU in vitro E.coli expression system
ACKR2 Recombinant Human Atypical chemokine receptor 2(ACKR2) CSB-CF004618HU in vitro E.coli expression system
ACKR3 Recombinant Human Atypical chemokine receptor 3(ACKR3) CSB-CF006257HU in vitro E.coli expression system
ACKR4 Recombinant Human Atypical chemokine receptor 4(ACKR4) CSB-CF865095HU in vitro E.coli expression system
ADRB2 Recombinant Human Beta-2 adrenergic receptor(ADRB2) CSB-CF001392HU in vitro E.coli expression system
Agtr2 Recombinant Rat Type-2 angiotensin II receptor(Agtr2) ,partial CSB-EP001466RA E.coli
C5AR2 Recombinant Human C5a anaphylatoxin chemotactic receptor 2(C5AR2) CSB-CF868390HU in vitro E.coli expression system
CCR1 Recombinant Human C-C chemokine receptor type 1(CCR1) CSB-CF004839HU in vitro E.coli expression system
CCR10 Recombinant Human C-C chemokine receptor type 10(CCR10) CSB-CF004840HU in vitro E.coli expression system
CCR2 Recombinant Human C-C chemokine receptor type 2(CCR2) CSB-CF004841HU in vitro E.coli expression system
CCR3 Recombinant Human C-C chemokine receptor type 3(CCR3) CSB-CF004842HU in vitro E.coli expression system
CCR4 Recombinant Human C-C chemokine receptor type 4(CCR4) CSB-CF004842HU in vitro E.coli expression system
CCR5 Recombinant Human C-C chemokine receptor type 5(CCR5) CSB-CF004844HU in vitro E.coli expression system
CCR6 Recombinant Human C-C chemokine receptor type 6(CCR6) CSB-CF004845HU in vitro E.coli expression system
CCR7 Recombinant Human C-C chemokine receptor type 7(CCR7) CSB-CF004846HU in vitro E.coli expression system
CCR8 Recombinant Human C-C chemokine receptor type 8(CCR8) CSB-CF004847HU in vitro E.coli expression system
CCR9 Recombinant Human C-C chemokine receptor type 9(CCR9) CSB-CF004848HU in vitro E.coli expression system
CCRL2 Recombinant Human C-C chemokine receptor-like 2(CCRL2) CSB-CF004852HU in vitro E.coli expression system
CREB1 Recombinant Human Cyclic AMP-responsive element-binding protein 1(CREB1) CSB-EP005947HU E.coli
CRHR1 Recombinant Human Corticotropin-releasing factor receptor 1(CRHR1),partial CSB-EP005965HU E.coli
CX3CR1 Recombinant Human CX3C chemokine receptor 1(CX3CR1) CSB-CF006236HU in vitro E.coli expression system
CXCR1 Recombinant Human C-X-C chemokine receptor type 1(CXCR1) CSB-CF006236HU in vitro E.coli expression system
CXCR2 Recombinant Human C-X-C chemokine receptor type 2(CXCR2) CSB-CF011673HU in vitro E.coli expression system
CXCR3 Recombinant Human C-X-C chemokine receptor type 3(CXCR3) CSB-CF006253HU in vitro E.coli expression system
CXCR4 Recombinant Human C-X-C chemokine receptor type 4(CXCR4) CSB-CF006254HU in vitro E.coli expression system
CXCR5 Recombinant Human C-X-C chemokine receptor type 5(CXCR5) CSB-CF006255HU in vitro E.coli expression system
CXCR6 Recombinant Human C-X-C chemokine receptor type 6(CXCR6) CSB-CF006256HU in vitro E.coli expression system
DGKE Recombinant Human Diacylglycerol kinase epsilon(DGKE) CSB-CF006835HU in vitro E.coli expression system
FPR1 Recombinant Human fMet-Leu-Phe receptor(FPR1),partial CSB-EP008854HU1d1 E.coli
Fpr2 Recombinant Mouse Formyl peptide receptor 2(Fpr2),partial CSB-EP008855MO1 E.coli
FSHR Recombinant Human Follicle-stimulating hormone receptor(FSHR),partial CSB-EP009021HU E.coli
Gcgr Recombinant Mouse Glucagon receptor(Gcgr),partial CSB-EP009316MO E.coli
GLP1R Recombinant Human Glucagon-like peptide 1 receptor(GLP1R) CSB-CF009514HU(A4) in vitro E.coli expression system
GNAI3 Recombinant Human Guanine nucleotide-binding protein G(k) subunit alpha(GNAI3) CSB-EP009591HU E.coli
GNAZ Recombinant Human Guanine nucleotide-binding protein G(z) subunit alpha(GNAZ) CSB-EP009601HU E.coli
GPR157 Recombinant Human G-protein coupled receptor 157(GPR157) CSB-CF713185HU in vitro E.coli expression system
HCRTR1 Recombinant Human Orexin receptor type 1(HCRTR1) CSB-YP010231HU1 Yeast
HTR1F Recombinant Human 5-hydroxytryptamine receptor 1F(HTR1F) CSB-CF010886HU in vitro E.coli expression system
HTR2B Recombinant Human 5-hydroxytryptamine receptor 2B(HTR2B) CSB-CF010888HU in vitro E.coli expression system
HTR7 Recombinant Human 5-hydroxytryptamine receptor 7(HTR7) CSB-CF010899HU in vitro E.coli expression system
LGR5 Recombinant Human Leucine-rich repeat-containing G-protein coupled receptor 5(LGR5),partial CSB-EP012906HU E.coli
NPFFR2 Recombinant Human Neuropeptide FF receptor 2(NPFFR2) CSB-YP015983HU Yeast
OR1A1 Recombinant Human Olfactory receptor 1A1(OR1A1) CSB-CF865201HU in vitro E.coli expression system
P2RY12 Recombinant Human P2Y purinoceptor 12(P2RY12) CSB-CF861997HU in vitro E.coli expression system
XCR1 Recombinant Human Chemokine XC receptor 1(XCR1) CSB-CF026188HU in vitro E.coli expression system

 

G protein-Coupled Receptor (GPCR) related antibodies for your research

Target Product Name Code Species Reactivity Tested Applications
ACKR1 ACKR1 Antibody CSB-PA006504GA01HU Human, Mouse, Rat ELISA, WB
ADGRE1 EMR1 Antibody CSB-PA007651GA01HU Human, Mouse, Rat ELISA, WB
ADORA1 ADORA1 Antibody CSB-PA001375GA01HU Human, Mouse, Rat ELISA, WB
ADRA1A ADRA1A Antibody CSB-PA001385GA01HU Human, Mouse, Rat ELISA, WB
ADRB2 ADRB2 Antibody CSB-PA001392GA01HU Human, Mouse, Rat ELISA, WB, IHC
ARRB1 ARRB1 Antibody CSB-PA002134GA01HU Human, Mouse, Rat ELISA, WB, IHC, IF
C1QTNF1 C1QTNF1 Antibody CSB-PA003646GA01HU Human, Mouse, Rat ELISA, WB, IHC
C5AR1 C5AR1 Antibody CSB-PA003996GA01HU Human, Mouse, Rat ELISA, WB, IF
CASR CASR Antibody CSB-PA004558GA01HU Human, Mouse, Rat ELISA, WB
CCR5 CCR5 Antibody CSB-PA004844GA01HU Human, Mouse, Rat ELISA, WB
CNR1 CNR1 Antibody CSB-PA005678GA01HU Human, Mouse, Rat ELISA, WB
CREB1 CREB1 Antibody CSB-PA005947GA01HU Human, Mouse, Rat ELISA, WB
CRY1 CRY1 Antibody CSB-PA006005GA01HU Human, Mouse, Rat ELISA, WB, IF
CX3CR1 CX3CR1 Antibody CSB-PA006236GA01HU Human, Mouse, Rat ELISA, WB
CXCR4 CXCR4 Antibody CSB-PA006254GA01HU Human, Mouse, Rat ELISA, WB
DRD1 DRD1 Antibody CSB-PA007178GA01HU Human, Mouse, Rat ELISA, WB
F2RL1 F2RL1 Antibody CSB-PA007925GA01HU Human, Mouse, Rat ELISA, WB
FZD9 FZD9 Antibody CSB-PA009112GA01HU Human, Mouse, Rat ELISA, WB
GABBR1 GABBR1 Antibody CSB-PA009134GA01HU Human, Mouse, Rat ELISA, WB
GGA2 GGA2 Antibody CSB-PA009385GA01HU Human, Mouse, Rat ELISA, WB
GNA13 GNA13 Antibody CSB-PA009585GA01HU Human, Mouse, Rat ELISA, WB
GNAI1 GNAI1 Antibody CSB-PA009588GA01HU Human, Mouse, Rat ELISA, WB, IHC
GPR17 GPR17 Antibody CSB-PA009778GA01HU Human, Mouse, Rat ELISA, WB
GPR22 GPR22 Antibody CSB-PA009796GA01HU Human, Mouse, Rat ELISA, WB
GPR37 GPR37 Antibody CSB-PA009810GA01HU Human, Mouse, Rat ELISA, WB
GRK2 ADRBK1 Antibody CSB-PA001394GA01HU Human, Mouse, Rat ELISA, WB, IHC
GRM1 GRM1 Antibody CSB-PA009931GA01HU Human, Mouse, Rat ELISA, WB
HCRTR1 HCRTR1 Antibody CSB-PA010231GA01HU Human, Mouse, Rat ELISA, WB
HRH1 HRH1 Antibody CSB-PA010737GA01HU Human, Mouse, Rat ELISA, WB, IHC
LGR6 LGR6 Antibody CSB-PA012907GA01HU Human, Mouse, Rat ELISA, WB, IHC
LHCGR LHCGR Antibody CSB-PA012911GA01HU Human, Mouse, Rat ELISA, WB, IHC
LPAR3 LPAR3 Antibody CSB-PA013049GA01HU Human, Mouse, Rat ELISA, WB
MCHR1 MCHR1 Antibody CSB-PA013584GA01HU Human, Mouse, Rat ELISA, WB
OPRL1 OPRL1 Antibody CSB-PA016360GA01HU Human, Mouse, Rat ELISA, WB, IHC
P2RY1 P2RY1 Antibody CSB-PA017326GA01HU Human, Mouse, Rat ELISA, WB, IHC
P2RY6 P2RY6 Antibody CSB-PA017337GA01HU Human, Mouse, Rat ELISA, WB
PRKAR1A PRKAR1A Antibody CSB-PA018694GA01HU Human, Mouse, Rat ELISA, WB
PTGER3 PTGER3 Antibody CSB-PA018972GA01HU Human, Mouse, Rat ELISA, WB
PTH2R PTH2R Antibody CSB-PA018990GA01HU Human, Mouse, Rat ELISA, WB, IHC
PTK2 PTK2 Antibody CSB-PA018993GA01HU Human, Mouse, Rat ELISA, WB, IHC
PTK2B PTK2B Antibody CSB-PA018994GA01HU Human, Mouse, Rat ELISA, WB, IHC
RGR RGR Antibody CSB-PA019640GA01HU Human, Mouse, Rat ELISA, WB, IHC
S1PR1 S1PR1 Antibody CSB-PA020650GA01HU Human, Mouse, Rat ELISA, WB
SCTR SCTR Antibody CSB-PA020865GA01HU Human, Mouse, Rat ELISA, WB
SH3GL2 SH3GL2 Antibody CSB-PA021231GA01HU Human, Mouse, Rat ELISA, WB, IHC
SSTR1 SSTR1 Antibody CSB-PA022724GA01HU Human, Mouse, Rat ELISA, WB
TACR1 TACR1 Antibody CSB-PA023068GA01HU Human, Mouse, Rat ELISA, WB
USP20 USP20 Antibody CSB-PA025711GA01HU Human, Mouse, Rat ELISA, WB, IHC
USP33 USP33 Antibody CSB-PA025724GA01HU Human, Mouse, Rat ELISA, WB, IHC

 

G protein-Coupled Receptor (GPCR) related ELISA kits for your research

Target Product Name Code Sample Type Sensitivity
ADRBK1 Human Beta-adrenergic receptor kinase 1(ADRBK1) ELISA kit CSB-EL001394HU serum, plasma, tissue homogenates, cell lysates 4.68 pg/mL
AGTR1 Human angiotensin Ⅱ receptor 1,ANGⅡR-1 ELISA Kit CSB-E11239h serum, plasma, tissue homogenates, cell lysates 11.72 pg/mL
APLNR Human Apelin receptor(APLNR) ELISA kit CSB-EL001910HU serum, plasma, tissue homogenates, cell lysates 5.8 pg/mL
ARRB2 Rat Beta-arrestin-2(ARRB2) ELISA kit CSB-EL002135RA serum, plasma, tissue homogenates, cell lysates 11.72 pg/mL
BDKRB1 Human B1 bradykinin receptor(BDKRB1) ELISA kit CSB-EL002651HU serum, plasma, tissue homogenates, cell lysates 6.25 pg/mL
C1QTNF1 Human Complement C1q tumor necrosis factor-related protein 1(C1QTNF1/CTRP1) ELISA Kit CSB-E16713h serum, plasma, tissue homogenates 0.078 ng/mL
CCR2 Human CC-Chemokine Receptor 2,CCR2 ELISA Kit CSB-E14200h serum, plasma, tissue homogenates, cerebrospinal fluid (CSF) 5.86 pg/mL
CCR2 Mouse C-C chemokine receptor type 2(CCR2) ELISA kit CSB-EL004841MO serum, plasma, tissue homogenates 3.9 pg/mL
CCR2 Rat C-C chemokine receptor type 2(CCR2) ELISA kit CSB-EL004841RA serum, plasma, tissue homogenates 3.9 pg/mL
CHRM1 Rat Muscarinic acetylcholine receptor M1(CHRM1) ELISA kit CSB-EL005381RA serum, plasma, tissue homogenates, cell lysates 3.9 pg/mL

The Collection of Drug Target Proteins

Currently, targeted therapy is an effective method for cancer, which presents instinct advantages over chemical therapy. However, the appropriate selection of drug targets is the key to the success in cancer therapy.

Accurate identification of drug targets is a crucial part of any drug development program. So-called drug targets, we usually refer to a series of protein, and they are also known as drug target protein. The development of this drugs aims to discover properties of proteins that may be important in determining their suitability for pharmaceutical modulation.

The most common drug target proteins include three types, involving CD antigen, FC receptor and immune checkpoint.

Here, based on cancer databases and latest researches of cancers, we collect the hot targets of six cancer, including breast cancer, lung cancer, thyroid cancer, prostate cancer, stomach cancer and ovarian cancer. Additionally, we compile the latest development of drug targets in clinic application, and related signaling pathways. We hope these information will give you some inspiration in cancer therapy.

Cancer Drug Targets

Breast Cancer

Breast cancer is a cancer that develops in the tissues of breasts. In the United States, breast cancer is a cancer that is ubiquitous in women, second only to skin cancer. Actually, breast cancer can occur in both men and women, but it’s far more common in women.

Supported for breast cancer awareness prevalence and accumulating research funding has helped created advances in the diagnosis and treatment of breast cancer. Breast cancer survival rates have increased, and the number of deaths associated with this disease is steadily declining.

Additionally, we have compiled popular targets related to breast cancer based on cancer databases and recent research. These targets are shown as follows:

CTLA4 EGFR MYC REL
TNFRSF14 TP53 YAP1

Lung Cancer

Breast cancer is a cancer that develops in the tissues of breasts. In the United States, breast cancer is a cancer that is ubiquitous in women, second only to skin cancer. Actually, breast cancer can occur in both men and women, but it’s far more common in women.

Supported for breast cancer awareness prevalence and accumulating research funding has helped created advances in the diagnosis and treatment of breast cancer. Breast cancer survival rates have increased, and the number of deaths associated with this disease is steadily declining.

Additionally, we have compiled popular targets related to breast cancer based on cancer databases and recent research. These targets are shown as follows:

APOE C3 CTGF CD160 CD19 CD40
CD40LG CD47 CD86 CD8A CLEC4C CTLA4
DLL3 EGFR ELANE FCGR3A FOLH1 FSHR
GSTP1 GUCY2C HAVCR2 HLA-E HLA-G IFIH1
KCNN4 LAMP1 LGR5 Ly75 MS4A1 MYC
NCL NECTIN2 NT5E REL RORC SIRPA
TEAD1 TNFRSF14 TNFRSF17 TNFRSF4 TNFRSF9 TNFSF4
TP53 TRIM21 TTR YAP1

Thyroid Cancer

As you know, thyroid is shaped like a small butterfly, and is usually found inside the lower front of your neck. It plays a critical role in regulating your metabolism. Moreover, it also releases hormones that direct many functions in your body, including the use of energy, heat production, and oxygen consumption. When it comes to pathological changes, the whole functions of your body are impacted.

Thyroid cancer is a typical cancer that develops from the tissues of the thyroid gland. It is a disease in which cells have undergone genetic mutation and grow abnormally. This disease also has the potential to spread to other parts of the body.

Currently, there is no clear reason why most people get thyroid cancer. Here, we have compiled popular targets related to thyroid cancer based on cancer databases and recent research. We hope there information would give you inspiration of thyroid cancer research. These targets are shown as follows:

C3 CD40LG FOLH1 HLA-E LGR5 MYC
NCL NT5E TNFSF4 TP53

Prostate Cancer

Prostate gland is a part of the male reproductive system that plays a role in semen production. Prostate cancer develops when the prostate cells undergo genetic changes. It is the most common malignancy among men (after skin cancer) and the cause of 1-2% of deaths in men. This disease can last several years or be lifelong. But, fortunately, it can often be treated successfully.

Here, we have compiled popular targets related to prostate cancer based on cancer databases and recent research. These targets are shown as follows:

APOE C3 CTGF CD160 CD40 CD40LG
CD47 CD86 CD8A CLEC4C DLL3 EGFR
FCGR3A FOLH1 FSHR GSTP1 GUCY2C HAVCR2
HLA-G KCNN4 LAMP1 LGR5 Ly75 MYC
NCL NECTIN2 NT5E SIRPA TEAD1 TNFRSF4
TP53

Stomach Cancer

Stomach cancer, also called gastric cancer, begins when cancer cells form in the inner lining of your stomach. These cells can grow into a tumor. The disease usually grows slowly over many years. This cancer is one of the most common malignant tumors worldwide.

According to statistics from the latest data, 876,000 new cases of gastric cancer occur every year in the world, accounting for 9% of all new cancer cases, and ranking fourth after lung cancer, breast cancer and intestinal cancer.

As mentioned, this disease usually grows slowly over many years. In other words, the cancer may not cause any signs or symptoms or it may cause only nonspecific symptoms in its early stages because the tumor is small.

Additionally, we have compiled popular targets related to stomach cancer based on cancer databases and recent research. These targets are shown as follows:

APOE C3 CTGF CD160 CD19 CD40
CD40LG CD47 CD86 CD8A CLEC4C CTLA4
DLL3 EGFR ELANE FCGR3A FOLH1 FSHR
GSTP1 GUCY2C HAVCR2 HLA-E HLA-G IFIH1
KCNN4 LAMP1 LGR5 Ly75 MS4A1 NCL
NECTIN2 NT5E REL RORC SIRPA TEAD1
TNFRSF14 TNFRSF17 TNFRSF4 TNFRSF9 TNFSF4 TP53
TRIM21 TTR YAP1 RORC SIRPA TEAD1

Ovarian Cancer

Ovarian cancer is a type of cancer that forms in the ovaries. It causes by abnormal cell that have the ability to invade or spread to other sections of your body.
Generally, the female reproductive system contains two ovaries, one on each side of the uterus. The ovaries produce eggs (ova) as well as the hormones estrogen and progesterone.

Similar as stomach cancer, ovarian cancer often goes undetected until it has spread within the pelvis and abdomen. But this time is the late stage of ovarian cancer. At this stage, ovarian cancer is more difficult to treat. However, early-stage ovarian cancer is usually confined to the ovary and more likely to be treated successfully.

Here, we have compiled popular targets related to ovarian cancer based on cancer databases and recent research. These targets are shown as follows:

C3 CTGF CD19 CD40 CD40LG CD47
CD86 CLEC4C CTLA4 EGFR FOLH1 FSHR
GUCY2C HLA-G IFIH1 KCNN4 LGR5 MS4A1
NCL NECTIN2 NT5E REL RORC SIRPA
TEAD1 TNFRSF9 TP53 TRIM21 YAP1

The latest Drug Research

Based on the latest drug research progression, we summarize the latest drug research of hot drug targets.

Target Marketed Drugs Development Drugs Latest Phase Indication
CTGF 0 1 Phase III Pancreatic Cancer; Duchenne Muscular Dystrophy; Idiopathic Pulmonary Fibrosis
CD160 0 3 Preclinical Autoimmune Disorders; Eye Disorders; Age-Related; Macular Degeneration; Aspergillosis; Chronic Lymphocytic Leukaemia
CD19 2 98 Marketed Leukaemia; Lymphoma
CD40 0 18 Phase I/II Cervical Cancer; Head And Neck Cancer; Penile Cancer; Solid Tumors; Autoimmune Disorders; Inflammation
CD47 0 14 Phase I Haematological Malignancies; Solid Tumors; Breast Cancer; Non-Hodgkin’s Lymphoma; Acute Myeloid Leukaemia; Myelodysplastic Syndromes; Mycosis Fungoides; Sezary Syndrome; Small Cell Lung Cancer
CD86 0 3 Preclinical Autoimmune Disorders; Cancer; Graft-Versus-Host Disease; Irritable Bowel Syndrome; Rheumatoid Arthritis; Graft-Versus-Host Disease; Irritable Bowel Syndrome; Rheumatoid Arthritis
CD8A 0 1 Preclinical Cancer; Precursor Cell Lymphoblastic Leukaemia-Lymphoma; Solid Tumors
CTLA4 3 13 Marketed Inflammation; Autoimmune Disorders; Rheumatoid; Arthritis; Cancer; Transplant Rejection; Malignant Melanoma; Renal Cell Carcinoma; Juvenile Rheumatoid Arthritis; Psoriatic Arthritis; Renal Transplant Rejection
DLL3 0 4 Preclinical Small Cell Lung Cancer; Solid Tumors; Acute Myeloid Leukaemia; Haematological Malignancies
EGFR 7 61 Marketed Colorectal Cancer; Head And Neck Cancer; Non-Small Cell Lung Cancer; Solid Tumors
FSHR 0 1 Preclinical Amyotrophic Lateral Sclerosis; Autistic Disorder; Charcot-Marie-Tooth Disease; Fragile X Syndrome; Polycystic Ovary Syndrome; Visceral Pain
HAVCR2 0 1 Preclinical Acute Myeloid Leukaemia; Haematological Malignancies; Multiple Myeloma
MS4A1 3 42 Marketed Haematological Malignancies; Lymphoproliferative Disorders; Non-Hodgkin’s Lymphoma; B-Cell Lymphoma; Chronic Lymphocytic Leukaemia; Diffuse Large B Cell Lymphoma; Follicular Lymphoma; Granulomatosis With Polyangiitis; Idiopathic Thrombocytopenic Purpura; Microscopic Polyangiitis; Nephrotic Syndrome; Pemphigus Vulgaris; Rheumatoid Arthritis
MYC 0 11 Phase III Cancer; Infections; Candidiasis; Cryptococcosis; Haematological Malignancies
REL 0 7 Preregistration Bacterial Infections; Neuropathic Pain; Diabetic Neuropathies; Eye Disorders; Intra-Abdominal Infections; Urinary Tract Infections; Major Depressive Disorder; Pneumonia
SIRPA 0 5 Phase I Cancer; Lymphoma; Multiple Myeloma
TNFRSF14SIRPA 0 1 Preclinical Solid Tumors
TNFRSF17 0 27 Phase III Multiple Myeloma; Solid Tumors; Acute Myeloid Leukaemia
TNFRSF9 0 10 Phase II Solid Tumors; Glioblastoma; Multiple Myeloma; Non-Hodgkin’s Lymphoma 2; Autoimmune Disorders
TTR 1 4 Marketed Amyloidosis; Amyloid Polyneuropathy; Cancer; Cardiomyopathies

Tag/Loading Control Antibodies

CUSABIO Tag/ Loading Control Antibodies include highly specific monoclonal and polyclonal antibodies.

Tag antibodies

Tag antibodies can be used for the detection and purification of multiple proteins with the same tag. When certain target proteins cannot be immunoprecipitated without specific antibodies, an epitope can be used to label the protein, and then select a tag antibody for this epitope so that the immunoprecipitation can be continued. With the rapid development of proteomics, the use of recombinant proteins has greatly increased in recent years. Recombinant hybrids contain an affinity tag such as GST, Myc, His, etc., which can be used to assist the purification of the target protein, which has been widely used.

CUSABIO tag antibodies are purified by antigen affinity, and they can specifically bind to the corresponding tag proteins, then identify and purify the target proteins as well. Some of our popular tag antibodies are listed as below for your reference.

Target Applications Target Applications
6*His ELISA, WB GFP ELISA,WB,IP
c-MYC ELISA, WB, IF, IP GST ELISA,WB
E-Tag ELISA, WB, IP HA-Tag ELISA, WB, IF, FC, IP
Flag Tag ELISA, WB, IP Sumo tag ELISA,WB

Loading control antibodies

Loading control antibodies are used to assesse western blotting efficiencies and compare the amounts of protein loaded in each well across a gel so that you can determine equal loading as well as the quality of the samples. It is important to use loading controls to determine protein expression and interpret Western blot results. Some common loading control antibodies include Beta Actin, GAPDH, Histone H3, Alpha Tubulin and Beta Tubulin, etc.

You cannot overemphasize the importance of loading control antibodies’quality. If the loading control is questionable, all of your results can be doubted. And CUSABIO is here to ease your worries. CUSABIO offers a wide selection of monoclonal loading control antibodies, including GAPDH, α-tubulin, and β-actin for several species. We also have some conjugated control antibodies, such as HRP- or biotin- conjugated control antibodies.

Here are the most hot-selling loading control antibodies.

Target Applications Target Applications
GAPDH ELISA, WB, IHC, IP, IF, FC TUBA1A ELISA, WB, IHC, IF, FC, IP
Beta-Actin ELISA PCNA ELISA

 

The Features of CUSABIO Tag/Control Antibodies

  • The diversity of Tags and Controls

  • High Sensitivity: Detects Lower Expression Levels

Western Blot analysis of HA-Tag Monoclonal Antibody (CSB-MA000141M0m)

Western Blot analysis of E-Tag Monoclonal Antibody (CSB-MA000151M0m)

Western Blot analysis of GAPDH Monoclonal Antibody (CSB-MA000071M0m)

  • Higher reliability: Small difference between batches

TUBA1A Monoclonal Antibody (CSB-MA754656A0m)

             

Lot Number: I0308A         Lot Number: I0424A

Flag Tag Monoclonal Antibody (CSB-MA000021M0m)

       

Lot Number: I0603A    Lot Number: I0419A

  • Multiple Validations

HA-Tag Monoclonal Antibody (CSB-MA000141M0m)

Western Blot (WB)

Positive WB detected in: 3 different overexpression lysates with HA tagged
All lanes: HA-Tag antibody at 1:1000

Flow cytometry (FC)

Overlay histogram showing 293F transfected cells stained with CSB-MA000141M0m (red line) at 1:100.

Immunoprecipitation (IP)

Immunoprecipitating HA-Tag in 293F transfected whole cell lysate.
Lane 1: Mouse control IgG (1µg); Lane 2: CSB-MA000141M0m (5µg) + 293F transfected whole cell lysate (500µg); Lane 3: 293F transfected whole cell lysate (20µg)

Immunofluorescence (IF)

Immunofluorescence staining of 293F transfected cells with CSB-MA000141M0m at 1:100, counter-stained with DAPI.

GAPDH Monoclonal Antibody (CSB-MA000071M0m)

CUSABIO Tag/Loading Control Antibodies Catalog

Here is the catalog of all Tag/Loading Control Antibodies Catalog.

 

Product Name Code Species Reactivity Application Size
GAPDH Monoclonal Antibody CSB-MA000071M2m Human, Rat, Rabbit, Mouse ELISA, WB, IHC, IP, IF 100μl/50μl
GAPDH Monoclonal Antibody CSB-MA000071M1m Human, Mouse, Rabbit ELISA, WB, IHC, IP, IF 100μl/50μl
TUBA1A Monoclonal Antibody CSB-MA754656A0m Human, Rabbit, Rat, Mouse ELISA, WB, IHC, IF, FC, IP 100ul/50ul
E-Tag Monoclonal Antibody CSB-MA000151M0m All ELISA, WB, IP 100μl/50μl
HA-Tag Monoclonal Antibody CSB-MA000141M0m All ELISA, WB, IF, IP, FC 100ul/50ul
Flag Tag Monoclonal Antibody CSB-MA000021M0m All ELISA, WB, IF, IP 100μl/50μl
Sumo tag Monoclonal Antibody CSB-MA000132M0m N/A ELISA,WB 100μg/50μg
GST Monoclonal Antibody CSB-MA000031M0m N/A ELISA, WB 100μg/50μg
GAPDH Monoclonal Antibody CSB-MA000071M0m Human, Rat, Rabbit ELISA, WB, IHC, IP, IF, FC 100μl/50μl
MBP Monoclonal Antibody CSB-MA000061M0m N/A ELISA,WB 100μg/50μg
Sumo tag Monoclonal Antibody CSB-MA000131M0m N/A ELISA,WB 100μg/50μg
GFP Monoclonal Antibody CSB-MA000051M0m N/A ELISA,WB,IP 100μg/50μg
Myc tag Monoclonal Antibody CSB-MA000041M0m N/A ELISA, WB, IF, IP 100μg/50μg
6*His Monoclonal Antibody CSB-MA000011M0m N/A ELISA, WB 100μl/50μl
Beta-Actin Monoclonal Antibody CSB-MA000091M0m Human ELISA 100μg/50μg
PCNA Monoclonal Antibody CSB-MA000081M0m N/A ELISA 100μg/50μg
TUBG1 Monoclonal Antibody CSB-MA080295 Human, Rat, Mouse ELISA, WB, IHC 100μg/50μg
ECFP-Tag Monoclonal Antibody CSB-MA080170 All ELISA,WB 100μg/50μg
RFP-Tag Monoclonal Antibody CSB-MA000332 N/A ELISA,WB 100μg/50μg
SRT-Tag Monoclonal Antibody CSB-MA000315 N/A ELISA,WB 100μg/50μg
Avi-Tag Monoclonal Antibody CSB-MA000314 N/A ELISA,WB 100μg/50μg
Myc-Tag Monoclonal Antibody CSB-MA000302 N/A ELISA,WB 100μg/50μg
His-Tag Monoclonal Antibody CSB-MA000300 N/A ELISA,WB 100μg/50μg
HA-Tag Monoclonal Antibody CSB-MA000299 N/A ELISA,WB 100μg/50μg
His-Tag Monoclonal Antibody CSB-MA000288 N/A ELISA,WB 100μg/50μg
TAP Tag Monoclonal Antibody CSB-MA000286 N/A ELISA,WB 100μg/50μg
CBP Tag Monoclonal Antibody CSB-MA000285 N/A ELISA,WB 100μg/50μg
HSV-Tag Monoclonal Antibody CSB-MA000272 N/A ELISA,WB 100μg/50μg
Myc-Tag Monoclonal Antibody CSB-MA000182 N/A ELISA,WB 100μg/50μg
HA-Tag Monoclonal Antibody CSB-MA000181 N/A ELISA,WB 100μg/50μg
Flag-Tag Monoclonal Antibody CSB-MA000180 N/A ELISA,WB 100μg/50μg
Myc-Tag Monoclonal Antibody CSB-MA000179 N/A ELISA,WB 100μg/50μg
His-Tag Monoclonal Antibody CSB-MA000178 N/A ELISA,WB 100μg/50μg
V5-Tag Monoclonal Antibody CSB-MA000177 N/A ELISA,WB 100μg/50μg
Trx-Tag Monoclonal Antibody CSB-MA000173 N/A ELISA,WB 100μg/50μg
S-Tag Monoclonal Antibody CSB-MA000172 N/A ELISA,WB 100μg/50μg
Strep-Tag Monoclonal Antibody CSB-MA000171 N/A ELISA,WB 100μg/50μg
KT3-Tag Monoclonal Antibody CSB-MA000170 N/A ELISA,WB 100μg/50μg
HSV-Tag Monoclonal Antibody CSB-MA000169 N/A ELISA,WB 100μg/50μg
E2-Tag Monoclonal Antibody CSB-MA000168 N/A ELISA,WB 100μg/50μg
T7-Tag Monoclonal Antibody CSB-MA000167 N/A ELISA,WB 100μg/50μg
RFP-Tag Monoclonal Antibody CSB-MA000166 N/A ELISA,WB 100μg/50μg
mCherry-Tag Monoclonal Antibody CSB-MA000165 N/A ELISA,WB 100μg/50μg
GFP-Tag Monoclonal Antibody CSB-MA000164 N/A ELISA,WB 100μg/50μg
MBP-Tag Monoclonal Antibody CSB-MA000163 N/A ELISA,WB 100μg/50μg
GST-Tag Monoclonal Antibody CSB-MA000162 N/A ELISA,WB 100μg/50μg
VSV-G-Tag Monoclonal Antibody CSB-MA000161 N/A ELISA, WB, IF, IP 100μg/50μg
V5-Tag Monoclonal Antibody CSB-MA000160 N/A ELISA, WB, IF, IP 100μg/50μg
His-Tag Monoclonal Antibody CSB-MA000159 N/A ELISA, WB, IF, IP 100μg/50μg
HA-Tag Monoclonal Antibody CSB-MA000158 N/A ELISA, WB, IF, IP 100μg/50μg
Myc-Tag Monoclonal Antibody CSB-MA000157 N/A ELISA, WB, IF, IP 100μg/50μg
Flag-Tag Monoclonal Antibody CSB-MA000156 N/A ELISA, WB, IF, IP 100μg/50μg
HistoneH3 CSB-MA010418A0m Human, Rat, Rabbit, Mouse 100μl/50μl
ACTB Monoclonal Antibody CSB-MA000091M1m Human, Mouse, Rat, Rabbit ELISA, WB, IHC, IF, FC, IP 100μl/50μl
GST Monoclonal Antibody CSB-MA000031M1m All ELISA, WB, IF, FC, IP 100μl/50μl
TUBB Monoclonal Antibody CSB-MA025318A0m Human, Rat, Rabbit, Mouse ELISA, WB, IHC, IF, FC, IP 100μl/50μl
GFP Monoclonal Antibody CSB-MA000051M1m N/A ELISA, WB, IF, FC, IP 100μl/50μl

Useful resources

What is a Tag Antibody? What are Tag Antibodies used for?

A tag, or an epitope tag, is an antigenic sequence such as a protein or a polyhistidine that is determinant for the binding of a special antibody, which determines the specificity of an antigen. The tag is usually added to a protein of interest by using genetic engineering, forming a fusion protein which is detected by a corresponding antibody. Antibodies that specially recognize and bind these tag epitopes are called epitope Tag antibodies or Tag antibodies. When no specific antibodies are available in the detection of protein of interest, tag antibodiees are alternative and needed. Tag antibodies are used for protein isolation and purification, the tracking of protein expression and localization, protein-protein interactions. Some common experiments such as ELISA, western blotting, immunofluorescence and immunoprecipitation often use different tag antibodies.

What is a Loading Control Antibody? What are Loading Control Antibodies used for?

Control antibodies, as the name means, are series of internal control antibodies. They specific for a highly and constitutively expressed protein. Generally, control antibody can be divided into two groups, including isotype control antibodies and loading control antibodies. The best loading control antibody should be constantly and stably expressed in different tissues and under different physiological and pathological conditions. Housekeeping proteins are typically ideal candidates of loading control antibodies. Loading control antibodies are necessary to obtain accurate expression data in the western blotting. They are responsible for monitoring target proteins in the western blotting, confirming equal sample loading and gel-to-membrane transfer that causes more intense staining at the edge of the blot, and guarding against the “edge effect” in order to normalize results. Loading control antibodies can be also used to detect whether protein loading variation has occurred and may interpret observed variations in the target band(s).

So it is important to know How to select right Loading Control Antibodies for your WB.

Immune checkpoints are regulators of immune activation by regulating the antigen recognition of T cell receptor (TCR) in the process of immune response. They play a key role in maintaining immune homeostasis and preventing autoimmunity.

Based on the different role for immune activation, immune checkpoints are divided into two types: co-stimulatory immune checkpoints and co-inhibitory immune checkpoints.

Co-stimulatory immune checkpoints refer to one kind of immune checkpoint which can stimulate immune progress, such as CD28, ICOS, and CD137.

On the contract, co-inhibitory immune checkpoints play a negative role to immune progress. They inhibit immune progress, such as PD1, CTLA-4, and VISTA.

In cancer, immune checkpoint mechanisms are often activated to suppress the nascent anti-tumor immune response. This has led to the development of several checkpoint inhibitor antibody drugs that are currently being tested in clinical trials or have been approved for a number of cancers.

The Products of Immune Checkpoints

Recently, the R&D team from CUSABIO has developed various recombinant proteins of immune checkpoints for the researchers in this filed.

These recombinant immune checkpoint proteins cover multiple species and labels, and their biological activities are strictly analyzed and verified before shipping. In addition, we provide protein customization service. If you can’t find the protein you need, please contact us for custom service.

Gene Name Uniprot ID Code Product Name Source
CD19 P15391 CSB-AP005061HU Recombinant Human B-lymphocyte antigen CD19(CD19),partial (Active) Mammalian cell
CTLA4 H0VUB1 CSB-AP005121GU Recombinant Guinea pig Cytotoxic T-lymphocyte associated protein 4(CTLA4),partial (Active) Yeast
TNFRSF9 Q07011 CSB-AP005131HU Recombinant Human Tumor necrosis factor receptor superfamily member 9(TNFRSF9),partial (Active) Mammalian cell
TNFRSF9 Q07011 CSB-AP005141HU Recombinant Human Tumor necrosis factor receptor superfamily member 9(TNFRSF9),partial (Active) Mammalian cell
TNFRSF9 Q07011 CSB-AP005151HU Recombinant Human Tumor necrosis factor receptor superfamily member 9(TNFRSF9),partial (Active) Mammalian cell
CD86 P42081 CSB-AP005161HU Recombinant Human T-lymphocyte activation antigen CD86(CD86),partial (Active) Mammalian cell
CD40 P25942 CSB-AP005171HU Recombinant Human Tumor necrosis factor receptor superfamily member 5(CD40),partial (Active)

Unavailable

Mammalian cell
CD40 P25942 CSB-AP005181HU Recombinant Human Tumor necrosis factor receptor superfamily member 5(CD40),partial (Active) Mammalian cell
CD40LG P29965 CSB-AP005191HU Recombinant Human CD40 ligand(CD40LG),partial (Active) E.coli
CD47 Q08722 CSB-AP005201HU Recombinant Human Leukocyte surface antigen CD47(CD47),partial (Active) Mammalian cell
CD47 Q08722 CSB-AP005211HU Recombinant Human Leukocyte surface antigen CD47(CD47),partial (Active) Mammalian cell
CD160 O95971 CSB-AP005221HU Recombinant Human CD160 antigen(CD160) (Active) Mammalian cell
CTLA4 P16410 CSB-AP005231HU Recombinant Human Cytotoxic T-lymphocyte protein 4(CTLA4),partial (Active) Mammalian cell
TNFRSF4 P43489 CSB-AP005241HU Recombinant Human Tumor necrosis factor receptor superfamily member 4(TNFRSF4),partial (Active) Mammalian cell
TNFRSF4 P43489 CSB-AP005251HU Recombinant Human Tumor necrosis factor receptor superfamily member 4(TNFRSF4),partial (Active) Mammalian cell
TNFSF4 P23510 CSB-AP005261HU Recombinant Human Tumor necrosis factor ligand superfamily member 4(TNFSF4),partial (Active)

Unavailable

Mammalian cell
SIRPA P78324 CSB-AP005271HU Recombinant Human Tyrosine-protein phosphatase non-receptor type substrate 1(SIRPA),partial (Active) Mammalian cell
HAVCR2 Q8TDQ0 CSB-AP005281HU Recombinant Human Hepatitis A virus cellular receptor 2(HAVCR2),partial (Active) Mammalian cell
HAVCR2 Q8TDQ0 CSB-AP005291HU Recombinant Human Hepatitis A virus cellular receptor 2(HAVCR2),partial (Active) Mammalian cell
Ctla4 P09793 CSB-AP005301MO Recombinant Mouse Cytotoxic T-lymphocyte protein 4(Ctla4),partial (Active) Mammalian cell
Q80WM9 CSB-AP005311MO Recombinant Mouse Tumor necrosis factor receptor superfamily member 14(Tnfrsf14),partial (Active) Mammalian cell
Tnfrsf4 P47741 CSB-AP005321MO Recombinant Mouse Tumor necrosis factor receptor superfamily member 4(Tnfrsf4),partial (Active) Mammalian cell
Tnfrsf4 P47741 CSB-AP005331MO Recombinant Mouse Tumor necrosis factor receptor superfamily member 4(Tnfrsf4),partial (Active)

Unavailable

Mammalian cell
Havcr2 Q8VIM0 CSB-AP005341MO Recombinant Mouse Hepatitis A virus cellular receptor 2 homolog(Havcr2),partial (Active) Mammalian cell
Cd47 Q61735 CSB-AP005351MO Recombinant Mouse Leukocyte surface antigen CD47(Cd47),partial (Active) Mammalian cell
EGFR P00533 CSB-MP007479HU Recombinant Human Epidermal growth factor receptor(EGFR),partial (Active) Mammalian cell
TNFRSF17 Q02223 CSB-MP023974HU1 Recombinant Human Tumor necrosis factor receptor superfamily member 17(TNFRSF17),partial (Active) Mammalian cell
TACSTD2 P09758 CSB-MP023072HU1 Recombinant Human Tumor-associated calcium signal transducer 2(TACSTD2),partial (Active) Mammalian cell
MSLN Q13421 CSB-MP015044HUc9 Recombinant Human Mesothelin(MSLN),partial (Active) Mammalian cell
CD44 P16070 CSB-MP004938HU(F1) Recombinant Human CD44 antigen(CD44),partial (Active) Mammalian cell
EPHA3 P29320 CSB-MP007723HU Recombinant Human Ephrin type-A receptor 3(EPHA3),partial (Active) Mammalian cell
CD274 Q9NZQ7 CSB-MP878942HU1 Recombinant Human Programmed cell death 1 ligand 1(CD274),partial (Active) Mammalian cell
KLRK1 P26718 CSB-MP012474HU1 Recombinant Human NKG2-D type II integral membrane protein(KLRK1),partial (Active) Mammalian cell
CD22 P20273 CSB-MP004900HU Recombinant Human B-cell receptor CD22(CD22),partial (Active) Mammalian cell
CD276 Q5ZPR3 CSB-MP733578HU Recombinant Human CD276 antigen(CD276),partial (Active) Mammalian cell

Biotinylated Proteins

1. What Are Biotinylated Proteins?

Biotinylated proteins are a category of proteins of which the amino acid or carbohydrate moiety are covalently linked with biotin molecules through chemical or enzymatic methods.

2. Why Are Proteins Biotinylated?

Biotin is broadly used as conjugate for proteins or antibodies in molecular biology and biotechnology. It is a small hydrosoluble molecule generated by plants and numerous prokaryotic organisms. The binding between biotin and streptavidin or avidin is one of the strongest known non-covalent biological interactions. Biotinylation of recombinant or purified proteins imports the biochemical properties of biotin to the target proteins without interfering with the properties of the original proteins themselves. In addition to biotin’s strong affinity for avidins, its relatively small size and its possession of an easily derivatized valeric side-chain make biotin well-suited for tagged proteins.

3. How Are Proteins Biotinylated?

Proteins can be enzymatically or chemically biotinylated. Chemical biotinylation of proteins can be achieved in vitro with chemical reagents, which allows biotin to be covalently coupled to any reactive functional group on the proteins. However, chemical biotinylation lacks reproducibility and varies from protein to protein, based on the availability of the functional groups. The number of biotins added is not uniform and the binding of biotin to sites of the target protein is uncontrollable. And the modification of certain lysine residues may lead to inactivation of the binding site(s).

CUSABIO’s biotinylated proteins are produced through the enzymatic method. The Avi-tag, a small peptide sequence of 15 amino acids, is fused to either the N or C terminus of the protein of interest. After fusion expression, proteins with Avitag can be linked to biotin at a lysine residue by biotin protein ligase (BPL) in vivo or in vitro to achieve protein biotinylation. Protein biotinylation based on Avitag technology ensures the biotinylation only occurs on the lysine residue of Avitag and does not affect the natural binding activities of the target proteins.

4. What Can Biotinylated Proteins Do?

Any biotinylated proteins can tightly bind to the ovalbumin avidin and the fungal protein streptavidin. Labeling recombinant or purified proteins with biotin can be used for protein capture, purification, immobilization, and functionalization, as well as multimerizing or bridging molecules. Biotinylated proteins can be easily purified using avidin-coated columns or beads.

Biotinylated proteins are routinely detected or purified with avidin conjugates in many protein research applications, including the enzyme-linked immunosorbent assay (ELISA), western blot (WB) analysis, immunohistochemistry (IHC), immunoprecipitation (IP), and other methods of affinity purification, cell surface labeling and flow cytometry/fluorescence-activated cell sorting (FACS).

CUSABIO’s biotinylated proteins have been pre-labeled and experimentally validated. They all made with every attention to details. Importantly, they have high activity, high purity, low lot-to-lot variation, and excellent detection sensitivity. Here list some of biotinylated proteins as follows:

 

Recombinant Human CD44, partial, Biotinylated (Active) (CSB-MP004938HU1j1-B)

Purity>92%

(Tris-Glycine gel) Discontinuous SDS-PAGE (reduced) with 5% enrichment gel and 15% separation gel.

Activity

Measured by its binding ability in a functional ELISA. Immobilized human TNFRSF14 (CSB-MP842173HU) at 5 μg/ml can bind Biotinylated human TNFSF14, the EC50 is 1.773-3.707 ng/ml.

Recombinant HumanTNFSF14, partial, Biotinylated (Active) (CSB-MP023991HUj7-B)

Purity>92%

(Tris-Glycine gel) Discontinuous SDS-PAGE (reduced) with 5% enrichment gel and 15% separation gel.

Activity

Measured by its binding ability in a functional ELISA. Immobilized Anti-CD44 Mouse Monoclonal Antibody (CSB-MA004938A0m) at 2 μg/ml can bind Biotinylated human CD44, the EC50 is 2.865-5.099 ng/ml.

Recombinant Human GHR, partial, Biotinylated (Active) (CSB-MP009411HUj1-B)

Purity>95%

(Tris-Glycine gel) Discontinuous SDS-PAGE (reduced) with 5% enrichment gel and 15% separation gel.

Activity

Measured by its binding ability in a functional ELISA. Immobilized human GH1 (CSB-MP009407HU) at 2 μg/ml can bind Biotinylated human GHR, the EC50 is 2.067-3.208 ng/ml.

Recombinant Human ULBP1, Biotinylated (Active) (CSB-MP887177HUj1-B)

Purity>95%

(Tris-Glycine gel) Discontinuous SDS-PAGE (reduced) with 5% enrichment gel and 15% separation gel.

Activity

Measured by its binding ability in a functional ELISA. Immobilized KLRK1 (CSB-MP012474HU1) at 10 μg/ml can bind human Biotinylated ULBP1, the EC50 is 4.254-7.295 ng/ml.

Recombinant Human TNFSF13B, partial (Active) (CSB-MP897523HU1-B)

Purity>92%

(Tris-Glycine gel) Discontinuous SDS-PAGE (reduced) with 5% enrichment gel and 15% separation gel.

Activity

Measured by its binding ability in a functional ELISA. Immobilized human BCMA (CSB-MP023974HU1) at 5 μg/ml can bind Biotinylated human TNFSF13B, the EC50 is 0.1752-0.3657 ng/ml.

All of Biotinylated Proteins

Gene Name Code Product Name Source Tag Info
ACE2 CSB-MP866317HU-B Recombinant Human Angiotensin-converting enzyme 2(ACE2),partial,Biotinylated (Active) Mammalian cell C-terminal mFc-Avi-tagged
CD44 CSB-MP004938HU1j1-B Recombinant Human CD44 antigen(CD44), partial, Biotinylated Mammalian cell C-terminal mFc-Avi-tagged
TNFSF14 CSB-MP023991HUj7-B Recombinant Human Tumor necrosis factor ligand superfamily member 14(TNFSF14), partial, Biotinylated Mammalian cell N-terminal hFc-Avi-tagged
GHR CSB-MP009411HUj1-B Recombinant Human Growth hormone receptor(GHR), partial, Biotinylated Mammalian cell C-terminal mFc-Avi-tagged
ULBP1 CSB-MP887177HUj1-B Recombinant Human UL16-binding protein 1(ULBP1), Biotinylated Mammalian cell C-terminal mFc-Avi-tagged
TNFSF13B CSB-MP897523HU1-B Recombinant Human Tumor necrosis factor ligand superfamily member 13B(TNFSF13B), partial, Biotinylated Mammalian cell N-terminal hFc-Avi-tagged

Kits

Assay kits are widely used in many research areas including life science research, drug discovery, environmental monitoring, etc. They have become an indispensable tool in experiments. The existence of assay kits allows the experimenter to get rid of the heavy reagent preparation and optimization process. Because of that, researchers get more time to do further study.

CUSABIO offers thousands of assay kits for researchers worldwide since 2007. These kits have most advantages of kits on the market, such as easy to use, time-efficient, wide application, etc. Moreover, CUSABIO provides 100% Risk-free Performance Guarantee so that the researchers don’t need to worry about the product quality.

ELISA Kits

13 years ago, CUSABIO started supplying ELISA Kits for researchers worldwide. After so many years’ effort, CUSABIO has a sound platform for the development of ELISA kit, mature antigen-antibody research and development system. We are proficient in a variety of ELISA technologies, such as the double-antibody sandwich method, double antigen sandwich method, (direct) competition ELISA, indirect competition ELISA, blocking method, indirect ELISA and other methods. Combined with diagnostic kits development team, we are able to develop the kits with clinical diagnostic level, and make the quality in the leading place worldwide. CUSABIO now offers a broad range of ELISA kits covering over 4,000 different assay targets.

CUSABIO ELISA kits have the advantages that most ELISA kits have, such as no special handling required, simple operation, various species, etc. However, CUSABIO has done much more to provide better products and services to every research.

Strict quality control and performance evaluation

Linearity ranges, LLD (Lower Limit of Detection), Precision, Recovery, Component and kit stability, Specificity, Natural sample detection, etc. Every detail is on our radar.

High Sensitivity

CUSABIO selects high-quality antibodies as the raw materials of ELISA kits, which ensure our kits have higher sensitivity generally. And we randomly compared CUSABIO ELISA kit sensitivity with different competitors’ assay across 21 popular protein targets and calculated the ratios. CUSABIO ELISA shows superior sensitivity.

Multiple Biological Samples

CUSABIO ELISA kits are validated in multiple biological samples: serum, plasma, body fluids such as urine, cell culture supernatant and cell /tissue lysate.

Food safety& Drug Residues ELISA kits

Food safety has become a global issue because it affects the health of everyone. CUSABIO also developed a series of ELISA kits for food safety& drug Residues such as Gentamicin (GEN), Kanamycin (KA), Aflatoxin, and so on.

Cited in more than 7000 references

After more than 13 years effort on developing good research tools for our customers, we are trusted by thousands of researchers all around the world. CUSABIO products are cited in more and more publications in well-known magazines such as Nature, PLOS One, JASN, Bio Factors, Society for Endocrinology, Scientific Reports, APS and so on.

100% Risk-free Performance Guarantee

We provide a replacement product or refund if the product doesn’t perform as promised in the manual.

Exosome Isolation Kits

3 years ago, CUSABIO started developing exosome isolation kits. The most excellent scientists of CUSABIO join the research. After so many experiments and analysises, we finally develop the exosome isolation kits that we can be proud of. Even though we are not the first company to make exosome isolation kits, our exosome isolation kits have better performance than many ones on the market.

ELISA Kits

ELISA kits are a quick, convenient, and accurate research tool for the detection and quantitation of targets of interest in cultures and samples. Because of their exceptional advantage, ELISA kits are used in many important research areas, including cancer, cardiovascular, cell biology, epigenetics, metabolism, immunology, neuroscience, signal transduction, etc.

CUSABIO has 13+ years of experience in manufacturing ELISA kits and has formed a sound platform for the development of ELISA kits.

As a trustworthy ELISA kit supplier, we offer 4000+ ELISA test kits mainly in sandwich ELISA format, including 3000 targets, covering species of human, mouse, rat, bovine, etc.

As your partner in biological research, we completely understand the hardships of your work, and we try our best support to your research by optimizing every detail of our products and service.

CUSABIO has the strictest quality control system to ensure every ELISA kit has no quality issues so that you can get accurate data in your experiments. And CUSABIO technical team will be on your back all the time.

Product Features

Ready-to-use

Each ELISA kit consists of a coated plate and a ready-to-use solution. No special handling required. Simple operation.

Multiple Species

CUSABIO ELISA kits cover more than 30 species with broad research areas, including human, mouse, rat, bovine, rabbit, pig, sheep, goat, monkey, etc.

High Sensitivity

We randomly compared our ELISA kits sensitivity with other suppliers’.

Multiple Biological Samples

CUSABIO ELISA kits are validated in multiple biological samples:
serum, plasma, body fluids, such as urine, cell culture supernatant, cell/ tissue lysate, tear, breast milk, saliva, etc.

Cited in more than 7000 References

CUSABIO ELSA kits are cited in more and more publications in well-known magazines such as Nature, PLOS One, JASN, Bio-Factors, Scientific Reports, APS and so on.

Useful Resources

What is ELISA?

ELISA, short for enzyme-linked immunosorbent assay, is a method to detect the presence of a ligand, which usually is a protein, in a liquid sample using antibodies directed against the protein to be measured.

Compared with other immunoassay methods, ELISA is featured with higher sensitivity, specificity and throughput. Moreover, it is easy to perform. These advantages make ELISA be a very popular choice for researchers from various areas.

How does an ELISA Kit Work? What is the Typical ELISA Workflow?

Firstly, the antigens of interest are immobilized on the microplate by overnight incubation. This step forms antigen-coated wells.

Secondly, add the enzyme-labeled antibodies to the wells. Sometimes the unconjugated antibodies are added before the addition of the enzyme-labeled antibodies according to the experiment requirement. The antigens are directly captured by the enzyme-labeled primary antibodies or indirectly captured via the enzyme-labeled secondary antibodies that have been attached to the unconjugated antibodies on the microplate.

Thirdly, specific biotinylated detection antibodies are added to the wells to enable detection of the captured antibodies. The addition of the substrate solution is then added to each well. The color reaction is presented after incubation of the plated at 37 degrees celsius for 5 minutes.

Here is the typical ELISA workflow.

Exosome Isolation Kits

A high-efficient exosome isolation kit can help a lot for every exosome researchers. High purity, high yield, and easy operation make it a great research tool.

As we know, exosomes are small membrane vesicles (30–150 nm) of endocytic origin, which are shed by all cell types under normal- and patho-physiological conditions. Exosomes have pleiotropic physiological and pathological functions and play significant roles in diverse pathological conditions such as cancer, infectious and neurodegenerative diseases.

Exosomes have received significant attention for their roles in pathobiological processes and are being explored as a tool for disease diagnosis and management. Consequently, various isolation methods based on different principles have been developed for exosome isolation such as differential ultracentrifugation, density gradient ultracentrifugation, ultracentrifugation, chromatography, magnetic bead immunoassay, polypolymer precipitation method, etc. However, the quick and easy operation of exosome isolation kits is irreplaceable.

CUSABIO Exosome Isolation Kits purify exosome by affinity purification. High Purity exosomes and other Evs (Extracellular vesicles) from cell culture medium and body fluid (high yield by normal microfiltration) can be easily obtained by this method.

Product Features

Suitable for many downstream experiments

The experiments include Transmission electron microscope analysis, Nanoparticle tracking analysis, NanoFCM analysis, Western Blot, Fluorescence quantitative (qPCR), High-Throughput Sequencing, etc.

Suitable for a variety of sample types

CUSABIO Exosome isolation kit provides a simple and reliable method to extract intact exosomes from the cell culture supernatant, serum, plasma, latex, urine, saliva, Yeast, Plant.

  1. Exosomes extracted from plasma
  2. Exosomes extracted from serum
  3. Exosomes extracted from urine
  4. Exosomes extracted from Hela cells
  5. Exosomes extracted from latex
  6. Exosomes extracted from latex

Exosomes extracted from Hela cells

Exosomes extracted from latex

Exosomes extracted from pichia pastoris

Exosomes extracted from serum

Exosomes extracted from saliva

Exosomes extracted from kluyveromyces lactis

Exosomes extracted from plasma

Exosomes extracted from urine

Can be used in the supernatant of a variety of cells

CUSABIO Exosome Isolation Kits are available to isolate exosomes from the supernatant of various cells, such as A375, HEPG2, PC-3, Hela, U87, MG63, etc.

ENO1 (CSB-MA007670A0m) GAPDH (CSB-MA000071M0m)

 

  1. Exosomes extracted from A375 cells,
  2. A375 cell Lysate
ENO1 (CSB-MA007670A0m) GAPDH (CSB-MA000071M0m)

 

  1. Exosomes extracted from HEPG2 cells
  2. Exosomes extracted from PC-3 cells
  3. Exosomes extracted from Hela cells
  4. Exosomes extracted from U87 cells
  5. Hela cell Lysate
ENO1 (CSB-MA007670A0m) GAPDH (CSB-MA000071M0m)

 

  1. Exosomes extracted from MG63 cells
  2. Exosomes extracted from Ntera-2 cells
  3. MG63 cell Lysate
ENO1 (CSB-MA007670A0m) GAPDH (CSB-MA000071M0m)

 

  1. Exosomes extracted from Raji cells
  2. Exosomes extracted from U251 cells
  3. Raji cell Lysate
CD63 (CSB-MA004950A0m) CD63 (CSB-MA004950A1m)

 

  1. Exosomes extracted from Hela cells
  2. Exosomes extracted from Hela cells
  3. Exosomes extracted from urine

High Purity

The exosomes extracted by CUSABIO kits are complete in shape, spherical or dish-shaped, with uniform particles. Vesicles are structurally intact. The following are a part of the results.

High Yield

There are up to 3 x 1011 particles of purified exosomes per millilitre.

CUSABIO (CSB-EI0102, CSB-EI0110)
Particle size: 79.19 nm
Concentration: 3.08*1011 particles /mL

High Efficiency

The exosomes extracted by CUSABIO Exosome Isolation Kit are superior to the other three well-known brand kits and comparable to ultracentrifugation.

  1. CSB-EI0102(2T), CSB-EI0110(10T)
  2. Company A
  3. Company B
  4. Company C
  5. Ultracentrifugation
  6. Hela Cell Lysate
GAPDH (CSB-MA000071M0m) CD9 (CSB-MA004969A0m)
ENO1 (CSB-MA007670A0m) PKM (CSB-MA018072A0m)

Simple to use

No ultracentrifugation or phenol/chloroform step required. No equipment requirement. Just follow our protocol, you will get the exosomes soon.

Competitive prices and excellent technical support

Prices of CUSABIO exosome isolation kits are very competitive. We have an efficient production and management system so that we can manufacture premium reagents at less cost and our customers can get better quotes.

What’s more, CUSABIO has a powerful technical support team and complete after-sales service here to meet the needs of every purchase so that you have no worry and save time & energy for your research.

Code Size Sample Types
CSB-EI0102 2T Cell Culture Supernatant, Serum, Plasma, Latex, Urine, Saliva
CSB-EI0110 10T Cell Culture Supernatant, Serum, Plasma, Latex, Urine, Saliva

Useful Resources

Q&A

How to preserve the purified exosome vesicles?

Store at 4℃ for short term storage or -80℃ for long term storage. It is recommended to store it after aliquoting to avoid repeated freezing and thawing.

How to obtain exosome-free serum culture cells?

a. Ultra-centrifuge the cell culture serum for 10 hours to remove exosomes from the serum (aseptic operation).

b. Choose serum-free media for cell culture.

c. Choose exosome-free serum for cell culture.

How to identify the exosomes extracted from the cells?

WB validation of specific markers, transmission electron microscope (TEM), particle size (NanoFCM, NTA), etc.

What are the advantages of CUSABIO exosome isolation kit over ultracentrifugation

a. Simple, stable and highly repeatable.

b. No equipment requirement.

How to extract/ isolate exosome with CUSABIO Exosome Isolation Kits?

What are exosomes used for?

Exosomes contain cell-specific cargos of nucleic acids, proteins, lipids, and metabolites, which facilitate intercellular communication that contributes to a spectrum of biological processes in health and disease. Exosomes are related to immune responses, viral pathogenicity, chronic inflammation, neurodegenerative and cardiovascular diseases, even cancer progression. Additionally, exosomes are engineered to therapeutic nanocarriers for drug and gene delivery to the desired target, thus achieving the therapeutic control of many diseases.

How do exosomes work?

Upon exosome binding to target cells through ligand-receptor interactions, the contents of exosomes are internalized into recipient cells. These biological active molecules, such as proteins, lipids, and genetic materials, that mediate exosomal intercellular communication, ultimately reprograming the recipient cells.

Are exosomes good or bad?

Exosomes play a dual role in human health. They keep cell health by removing damaged and unwanted proteins and structures in the cells. And they are also involved in immunity and reproduction in healthy individuals. However, cancer-derived exosomes participate in tumor growth, progression, dissemination, angiogenesis, and metastasis by transferring their cargoes of cytokines, mRNAs, and miRNAs to targeted cells. Anti-cancer therapy resistance is also attributed to exosomes of tumor origin. Besides, some exosomes are implicated in the pathogenesis of the disease, including neurodegenerative and cardiovascular diseases.

What is exosome therapy?

Exosome therapy is a form of regenerating treatment in which therapeutic payloads are delivered through exosomes to the affected site to achieve therapeutic effects. Therapeutic exosomes are administered through injection or infusion into the treatment location, where they target and release their content of endogenous and modified bioactive molecules, such as miRNA and proteins into damaged cells or tissues, stimulating quicker healing and diminish inflammation.

Are exosomes better than stem cells?

Compared to stem cells, exosomes are simpler, safer, cheaper, more easily stored and transported. In terms of therapeutic effects, exosome shows very low immunogenicity and do not trigger complications. Additionally, exosomes can not replicate, do not deteriorate, and are not infected by viruses.

More Information about Exosomes

Why Study Exosomes?

Extracellular vesicles (EVs) are small membrane vesicles, composed of a lipid bilayer with inserted transmembrane proteins, enclosing cytosolic components (protein, mRNA, and miRNA) derived from the EV-producing cells.

These EVs such as exosomes have been found in biofluids, including blood, saliva, urine, cerebrospinal fluid (CSF) and latex, act as messengers of intercellular communication networks. EVs carry lipids, proteins, and RNAs derived from their producing cells, and have potential as biomarkers specific to cell types and even cell states.

How Do You Get Exosomes?

However, conventional methods (such as ultracentrifugation or polymeric precipitation) for isolating EVs have disadvantages regarding purity and feasibility.

CUSABIO offers a wide range of diagnostic kits for food safety & drug residues in feed and food. CUSABIO develops effective solutions for the analysis of food and feed samples. The CUSABIO elisa kit are especially designed to meet high quality demands in feed and food testing focusing mainly on chemical contaminants comprising on natural and artificial contaminants. Our main lines are antibiotics, mycotoxins and hormones testing solutions.

Product Name Code Size
Ochratoxin A(OTA)ELISA Kit CSB-EFD027449 96T
Amantadine ELISA Kit CSB-E51A 96T
Malachite Green ELISA Kit CSB-EFD027642 96T
Fumonisin B1 ELISA Kit CSB-E11104 96T
Aminohydantoin (ADH) ELISA kit CSB-EFD028242 96T
Furaltadone Metabolite (AMOZ) ELISA kit CSB-EFD028241 96T
Dexamethasone (DXM) ELISA kit CSB-EFD028240 96T
Phenylethanolamine A ELISA kit CSB-EFD028239 96T
Sulfonamides (SAs) residue ELISA kit CSB-E12094f 96T
Clenbuterol (CL) ELISA kit CSB-E12022f 96T
Chloramphenicol (CAP) ELISA kit CSB-E12037f 96T
Aflatoxin B1(AFB1)ELISA kit CSB-E14087 96T
Ractopamine (RA) ELISA kit CSB-E12023f 96T
Tylosin (TYL) ELISA kit CSB-EFD028231 96T
Erythromycin (E-Mycin) ELISA kit CSB-EFD028230 96T
Neomycin (NMC) ELISA kit CSB-EFD028229 96T
Salbutamol (SALB) Elisa kit CSB-EFD028179 96T
Kanamycin (KA) Elisa Kit CSB-EFD1027696 96T
Fluoroquinolones ELISA kit CSB-E12036f 96T
Gentamicin (GEN) ELISA kit CSB-E12088f 96T
Sulfamethoxazole (SMZ/SMX) ELISA kit CSB-EFD027641 96T
Total Aflatoxins ELISA Kit CSB-E09923 96T
Enrofloxacin (ER) ELISA kit CSB-E12035f 96T
Nitrofurazone(SEM) ELISA kit CSB-E12030f 96T
Tetracyclines ELISA Kit CSB-E12090f 96T
Streptomycin (SM) ELISA kit CSB-E12087f 96T
Sulfathiazole (ST) ELISA kit CSB-E12083f 96T
Aflatoxin M1(AFM1)ELISA kit CSB-EL027236 96T
Penicillin G(benzyl penicillin) ELISA kit CSB-E12095f 96T
Furazolidone(AOZ) ELISA kit CSB-E12038f 96T
T-2 toxin (T2) ELISA kit CSB-EFD027448 96T
Deoxynivalenol(DON) ELISA Kit CSB-E12829f 96T
Zearalenone(ZEN) ELISA kit CSB-E12830f 96T

FAQs

Storage

Please store unopened kit at 2-8 ℃ and use the kit before expiration date. For opened kit, which is vulnerable to germ contamination, it’s better to use it as soon as possible. NEVER store the ELISA plate at -20 ℃ and the substrate solution should be kept in dark both during storage and usage.

Reagents preparation

Please finish preparing reagent 10 minutes before using. Centrifugation is required for all reagent components when using for the first time so as to concentrate them to the bottom of the tube. Please use precise measuring tools (pipette, graduated cylinder etc.) for reagent preparation, because the actual quantity provided for each reagent (eg: Wash Buffer,Sample Diluent) is more than what the label says. NEVER take the labeled quantity for granted and add solution directly into the vials for reagent preparation. All experimental apparatus should be clean and you’d better refer to the insert for details of reagent preparation.

ELISA plate

It’s OK that the aluminum foil bags is leaking since it won’t affect the quality of the plate. The strips are movable and it’s recommended to separate those wells needed for assay and store the rest at 2-8 ℃ in dark without germ contamination. NEVER expose the whole plate when only some of them are needed.

Samples or reagents adding

It is recommended that the whole time for sample adding should be controlled in 5 minutes and added volume for each well should be the same to keep reaction consistency.

Incubation

To avoid sample evaporation and contamination, proper adhesion of plate sealers during incubation steps is necessary. Be careful and do not spill the liquid when moving the plate. Since temperature stability is very important, please carefully monitor incubating temperature and keep it at 37℃. but avoid opening the door of incubator too many times during incubation.

Washing

Please ensure the same wash buffer volume per well and you’d better use multi-channel pipette. If you use the ELISA Washer, please make sure it’s clean enough without contamination. No rinse but gently wash. Throw plates vertically and wash it thoroughly to reduce the edge effect. For detailed procedure, please refer to the manual insert.

Reading

Please read the plate in 5 minutes after adding the stop solution to avoid generation of brown precipitate that may affect the result. Make sure that the microplate reader is set correctly and the filter is precisely calibrated.

Mixing

Do not make mix use of reagents within different lot#. Also, cross-use of caps matched to different reagents is also forbidden. NEVER replace components of our kit with other’s.

Services

Cusabio offers a variety of services in the following areas;

  • Phage Display
  • Antibody
  • Protein
  • Gene Synthesis
  • Oligo Synthesis

CUSABIO has been specialized in developing&producing antibodies for more than ten years, so we are confident that we have expertise, experience as well as enabling technologies on antigen design and antibody purification to customize the high quality antibodies that you are desiring.

Recombinant Antibody Production

Recombinant antibody, also known as genetic engineering antibody, refers to the usage of recombinant DNA and protein engineering technology to modify or recombine antibody genes according to various needs, then expressed after transfection via appropriate receptor cell.
Cusabio could offer one-stop service of recombinant antibody production to customers upon your various needs.
The production process of Cusabio custom recombinant antibody is as follows.

production process of Cusabio custom recombinant antibody

Process & Deliverables:

Antigen Preparation Process Deliverables Production Time
Peptide Synthesis Select Positive Gene
↓Recombinant Antibody Expression
↓Protein A/G Purification
↓ELISA, WB Validation
  1. QC report of antigen;
  2. 100ug×purified recombinant antibodies together with QC report, including the information of gene sequencing, concentration, purity and endotoxin content;
  3. WB positive guarantee for antigen;
  4. Other applications(IHC, IF, IP, FC, ChIP) could be available upon customers’ requests.
8-16 weeks
Recombinant Protein Production 12-16 weeks
Native Protein Selection 12-16 weeks

Successful Showcase (partial)

WB application of Phospho-RSK1 antibody WB application of Phospho-POLR2A antibody
Western Blot
Positive WB detected in:A549 whole cell lysate,Hela whole cell lysate,HepG2 whole cell lysate
primary antibody: Phospho-RSK1 antibody at 1.75µg/ml
Secondary antibody:
Goat polyclonal to rabbit IgG at 1/50000 dilution
Predicted band size: 90 KDa
Observed band size: 90 KDa
Western Blot
Positive WB detected in:Hela whole cell lysate, A549 whole cell lysate,293 whole cell lysate
primary antibody:Phospho-POLR2A antibody at 1.02µg/ml
Secondary antibody:
Goat polyclonal to rabbit IgG at 1/50000 dilution
Predicted band size: 270 KDa
Observed band size: 270 KDa
WB application of Phospho-LAT antibody WB application of Phospho-SHP2 antibody
Western Blot
Positive WB detected in:Jurkat whole cell lysate,Hela whole cell lysate,HepG2 whole cell lysate(treated with EGF or Pervanadate)
primary antibody:Phospho-LAT antibody at 2.9µg/ml
Secondary antibody:
Goat polyclonal to rabbit IgG at 1/50000 dilution
Predicted band size: 38 KDa
Observed band size: 38 KDa
Western Blot
Positive WB detected in:Hela whole cell lysate,293 whole cell lysate,A549 whole cell lysate(treated with Pervanadate or not)
primary antibody: Phospho-SHP2 antibody at 0.65µg/ml
Secondary antibody:
Goat polyclonal to rabbit IgG at 1/50000 dilution
Predicted band size: 68 KDa
Observed band size: 68 KDa

Monoclonal Antibody Production

Cusabio monoclonal antibodies are made by identical immune cells from a unique parent cell, which have better affinity compared with the same kind polyclonal antibodies.
Cusabio could offer a reliable production of custom monoclonal antibodies upon customers’ various demands. Based on large-scale production as well as high quality, Cusabio custom monoclonal antibodies have been widely used in screening therapeutic targets and drugs discovery.
The production process of Cusabio custom monoclonal antibody is as follows.

Production process of Cusabio custom monoclonal antibody

Process & Deliverables:

Immunogen Options Process Deliverables Production Time
Peptide Antigen Preparation

Animals Immunization

Serum Titer Detection

Affinity or Protein A/G Purification

WB Validation with Antigen
  1. QC report of antigen;
  2. 100ul×ascites;
  3. 1-2mg×monoclonal antibodies purified by protein A/G;
  4. ELISA titer guarantee 1:10000;
  5. WB positive guarantee for antigen;
  6. Validation report of hybridoma;
  7. Other applications(IHC, IF, IP, FC) could be available upon customers’ requests.
18-22 Weeks
Recombinant Protein 20-24 Weeks
Native Protein 20-24 Weeks
IP validation of PODXL antibody IF validation of NES antibody
Immunoprecipitating PODXL in HEK293 whole cell lysate
Lane 1: Rabbit monoclonal IgG(1 ug)instead of PODXL in HEK293 whole cell lysate. For western blotting,a HRP-conjugated Protein G antibody was used as the secondary antibody (1/2000)
Lane 2: PODXL(8 ug)+ HEK293 whole cell lysate(500 ug)
Lane 3: HEK293 whole cell lysate (10 ug)
Immunofluorescence staining of A549 cells with A antibody at 1:100, counter-stained with DAPI. The cells were blocked in 10% normal Goat Serum and then incubated with the primary antibody overnight at 4°C.The secondary antibody was Alexa Fluor 488-congugated AffiniPure Goat Anti-Mouse IgG (H+L).
IHC validation of PODXL antibody Overlay histogram of NES antibody
IHC image of A antibody diluted at 1:100 and staining in paraffin-embedded human kidney tissue performed on a Leica BondTM system. After dewaxing and hydration, antigen retrieval was mediated by high pressure in a citrate buffer (pH 6.0). Section was blocked with 10% normal goat serum 30min at RT. Then primary antibody (1% BSA) was incubated at 4°C overnight. The primary is detected by a biotinylated secondary antibody and visualized using an HRP conjugated SP system. Overlay histogram showing THP-1 cells stained with CD31 (red line) at 1:500. The cells were incubated in 1x PBS /10% normal goat serum to block non-specific protein-protein interactions followed by primary antibody for 1 h at 4℃.The secondary antibody used was FITC goat anti-mouse IgG (H+L) at 1/200 dilution for 1 h at 4℃. Isotype control antibody (green line) was used under the same conditions. Acquisition of >10,000 events was performed.
Western Blot validation of PODXL antibody Western Blot validation of NES antibody
Western Blot
Positive WB detected in:Hela whole cell lysate,HEK293 whole cell lysate
All lanes : PODXL antibody at 2.5 ug/ml
Secondary
Goat polyclonal to Mouse IgG at 1/5000 dilution
Predicted band size: 59KDa, 56KDa
Observed band size: 59KDa
Western Blot
Positive WB detected in:U251 whole cell lysate,SH-Sy5y whole cell lysate
All lanes :NES antibody at 3 ug/ml
Predicted band size: 260KDa
Observed band size: 260KDa

Polyclonal Antibody Production

Cusabio offers a reliable and wide range of custom polyclonal antibody production with multiple immunogen options as well as multiple host species options.
The production process of Cusabio custom polyclonal antibody is as follows.

production process of Cusabio custom polyclonal antibody

Process & Deliverables:

Immunogen Options Process Deliverables Production Time
Peptide Antigen Preparation

Animals Immunization

Serum Titer Detection

Affinity or Protein A/G Purification

WB Validation with Antigen
  1. QC report of antigen;
  2. ELISA titer guarantee 1:64000;
  3. WB positive guarantee for antigen;
  4. 1ml×preimmune serum, 2ml×anti-serum, 5-10mg×antibodies purified by protein A/G;
  5. Antibody purity guarantee 90% by SDS-PAGE detection.
12-14 Weeks
Recombinant Protein 14-16 Weeks
Native Protein 12-14 Weeks
ELISA application of an CUSABIO antibody
ELISA
Antigen coating concentration 2 ug/ml
Antiserum 1:2000 is more than diluted
Secondary:Goat polyclonal to rabbit IgG at 1/50000 dilution
IHC image of A antibody diluted at 1:400 Immunofluorescence staining of HepG2 cells with A antibody
IHC image of A antibody diluted at 1:400 and staining in paraffin-embedded human adrenal gland tissue performed on a Leica BondTM system. After dewaxing and hydration, antigen retrieval was mediated by high pressure in a citrate buffer (pH 6.0). Section was blocked with 10% normal goat serum 30min at RT. Then primary antibody (1% BSA) was incubated at 4°C overnight. The primary is detected by a biotinylated secondary antibody and visualized using an HRP conjugated SP system. Immunofluorescence staining of HepG2 cells with A antibody at 1:400,counter-stained with DAPI. The cells were fixed in 4% formaldehyde, permeabilized using 0.2% Triton X-100 and blocked in 10% normal Goat Serum. The cells were then incubated with the antibody overnight at 4°C.The secondary antibody was Alexa Fluor 488-congugated AffiniPure Goat Anti-Rabbit IgG (H+L).
Positive Western Blot application WB application of an antibody
Western Blot
Positive WB detected in:K562 whole cell lysate,HL-60 whole cell lysate,Hela whole cell lysate, MCF-7 whole cell lysate, HepG2 whole cell lysate,Rat liver tissue, Mouse brain tissue, Mouse lung tissue
All lanes:a antibody at 2ug/ ml
Secondary
Goat polyclonal to rabbit IgG at 1/50000 dilution
Predicted band size: 64 KDa
Observed band size: 64 KDa
Western blot
WT: Wild-type 293 cells
KO: Knockout 293 cells

Modification-specific Antibody Production

Any one modification-specific antibody can discriminate the difference of combination sites between modified and non-modified forms of an individual protein, which enables qualitative and quantitative detection of modified proteins to study the protein activity.
Cusabio could customize modification-specific polyclonal or monoclonal antibodies, which are affinity-purified without any cross-reactivity with non-modified forms of proteins.
The production process of Cusabio custom modification-specific antibody is as follows.

Production process of Cusabio custom modification-specific antibody

Process & Deliverables:

Antibody Type Antigen Preparation Process Deliverables Production Time
Modification-specific Polyclonal Antibody Peptide Synthesis Animals Immunization

Serum Titer Detection

Affinity Purification

WB Validation with Antigen
  1. HPLC report of antigen;
  2. ELISA titer guarantee 1:10000;
  3. WB positive guarantee for antigen;
  4. 1ml×preimmune serum, 2ml×anti-serum, 1mg×antibodies purified by antigen affinity.
12-14 Weeks
Modification-specific Monoclonal Antibody Peptide Synthesis 12-14 Weeks

Why choose us?

Multiple Immunogen Options

Peptide

Native Protein

Recombinant Protein

Multiple Host Species Options

Multiple Applications Options

CUSABIO Recombinant Protein Expression Service
12 years’experience, 15000+ orders completed, 99.1% success rate

In vitro E.coli Expression System

Introduction:

The cell-free protein expression system is also known as the in vitro translation system. The cell-free protein synthesis system uses the target mRNA or DNA as the template, adds the substrate and energy required for the protein synthesis to the enzyme system from the cell extract, and synthesize the target protein in vitro. The cell-free protein expression system simulates in vivo cells and reproduces the intracellular protein transcription and translation process. It needs the existence of various materials required for protein synthesis, including energy, transcription factors, and translation factors, etc.

The system is particularly suitable for the expression of transmembrane proteins and toxic proteins. Its feature includes short cycle and high-throughput.

Even though the system has more than 10 years of history, it still has some technical difficulties. Currently in the global base, cell-free protein expression is mainly provided through Rothe, Promega and other companies using kit expression, which has only very limited conditions and be very expensive. Our company is the first company to master the full set of core technology of E.coli cell-free expression system in domestic market, all core components are produced in house, and the reaction system contains more than 40 ingredients, which are easy to be adjusted and optimized. Since the establishment of this platform in 2015, 162 proteins have been successfully produced with yield of mg/ml, which contains 99 transmembrane proteins with 1-12 transmembrane domains and toxic proteins that are difficult to express in traditional E.coli expression systems. We have also produced high molecular weight proteins (130 kDa -140 kDa) that contain multiple transmembrane domains.

Advantages:

Compared with the traditional intracellular protein expression system, the cell-free system has the following significant advantages:

  • High yield, some protein can reach as high as 5 mg/ml. Currently, most of membrane protein data are obtained from the E. coli cell-free expression system
  • No restrictions on cell structure, it can express exogenous proteins that are toxic to the host cells
  • High-throughput, it allows expression of several different proteins simultaneously on the multi-well plate under a variety of different conditions. It is suitable for high-throughput proteomics research
  • The open reaction system makes the reaction conditions easy to change, which is helpful to regulate gene transcription, protein synthesis and post-translational modification
  • Allow addition of non-natural amino acids or isotope-labeled amino acids to synthesize proteins for special use
  • Less steps, simple experimental process, low dependence on equipment
  • Low Price, delivery time as short as 25 business days

Guarantee:

Risk-free: We do NOT charge if we cannot deliver the protein.

Note: This risk-free custom protein service is only suitable for proteins within 800aa. We will charge according to different steps if you need to express proteins more than 800aa.

Service Process:

Steps Project Process Cusabio Features Lead Time
1 Plasmid construction and preparation  Codon optimization, gene synthesis Multi-vector optimization
In order to improve the efficiency of mRNA translation, thereby increasing protein yield, we provide protein expression service using N-terminal peptide optimization in addition to conventional N-terminal fusion protein. The N-terminal peptide contains 6-11 amino acids, it’s the shortest additional amino acid sequence that we have designed.
15-20 business days
The PCR amplification products are ligated to the pET vectors by restriction enzyme digestion
Recombinant plasmids are prepared in large quantities
2 Small-scale expression and optimization  Multi-condition optimization;
SDS-PAGE electrophoresis;
Determine the optimal reaction condition
Multi-condition expression scheme
In cell-free expression system, we can express several different proteins simultaneously on the multi-well plate under a variety of different conditions. Thus we offer multi-condition optimization service.
7-10 business days
(Additional 3 business days for multi-condition purification)
3 Target protein expression and purification Prepare 1-10ml large-scale expression based on the small-scale results
The target protein is purified by exploring different chromatographic conditions including ion exchange chromatography, size exclusion chromatography and others by using AKTA, and then determine the optimal purification method. Multi-condition purification scheme (optional)
For transmembrane proteins, we provide different detergent purification services to determine the optimum buffer for your transmembrane protein. This purification scheme is most suitable for transmembrane proteins with bioactivity.
4 Additional services (optional) Charge Tag-removal service Flexible additional services
Customers can flexibly choose from a variety of additional services to their specific needs, e.g. Endotoxin removal, Filter-sterilization, Tag removal, Lyophilization, etc. Some are complimentary, and some require additional charge.
3 business days
Free Endotoxin removal, Filter-sterilization, Lyophilization (Note: Lyophilization and filter-sterilization can not be met at the same time) 2 business days
5 Quality Control Testing of purity, concentration, etc. QC report is provided. Detailed COA report
Detailed product data sheet and COA are provided for each project.
3-5 business days
Total lead time 25-35 business days

Platform introduction:

Characteristic expression systems

pET-23a(+)-JT vector, efficient expression in vitro

Vector characteristics:

1. Carrys T7 strong promoter, does not contain lac operon, no negative repressive effect, can express protein efficiently;

2. Compared with conventional 6xHis tag, the N-terminal 10xHis tag has a stronger binding ability in IMAC. The thrombin site makes it easy to remove the tag.

3. The C-terminal MYC-tag can be used for WB detection, and it has stronger sensitivity compared with His-tag.

4. Amp resistance screening.

Project showcase

Case 1
The following three items are proteins with 5, 6 and 7 transmembrane domains separately. Since the in vivo expression system is difficult to express multiple transmembrane proteins, or the yield is very low, CUSABIO use cell-free expression system to produce these three proteins. To increase the yield, we explored a variety of expression conditions for the customer. Figure 1, 2, and 3 have shown the small scale expression of these three proteins under different conditions, and we selected the optimal condition for the large-scale expression.

  • Lane 1: Reaction Condition1
  • Lane 2: Reaction Condition 2
  • Lane 3: Reaction Condition 3
  • Lane 4: Reaction Condition 4
  • Lane 5: Reaction Condition 5
  • Lane 6: Reaction Condition 6
  • Lane 1: Reaction Condition1
  • Lane 2: Reaction Condition 2
  • Lane 3: Reaction Condition 3
  • Lane 4: Reaction Condition 4
  • Lane 5: Reaction Condition 5
  • Lane 6: Reaction Condition 6
  • Lane 1: Reaction Condition1
  • Lane 2: Reaction Condition 2
  • Lane 3: Reaction Condition 3
  • Lane 4: Reaction Condition 4
  • Lane 5: Reaction Condition 5
  • Lane 6: Reaction Condition 6

Case 2
The project was a 9 transmembrane protein. The difficulty of this project was not only the large number of transmembrane domains, but also the high molecular weight (141.7 kDa). After multiple-condition optimization, we successfully produced the protein with high yield, which can be observed on SDS-PAGE.

  • Lane 1: Reaction Condition1
  • Lane 2: Reaction Condition 2
  • Lane 3: Reaction Condition 3
  • Lane 4: Reaction Condition 4
  • Lane 5: Reaction Condition 5

Case 3
The protein in this project had a very low yield. Through optimization of different N-terminal peptides, the yield was improved dramatically, as shown in Figure 5.

  • Lane 1: Tag 1
  • Lane 2: pET-28a(+) control
  • Lane 3: Tag 2
  • Lane 4: Tag 3
  • Lane 5: Tag 4
  • Lane 6: Tag 5
  • Lane 7: Tag 6
  • Lane 8: Tag 7

Case 4
HTR1B is a membrane protein of the GPCR family. It contains 7 transmembrane domains. We successfully expressed this protein and did the functional activity test, and the result has shown that the protein is bioactive.

The Binding Activity of HTR1B (7TM) with GSTK1

Activity :Measured by its binding ability in a functional ELISA. Immobilized HTR1B at 5 μg/ml can bind human GSTK1,the EC50 of human GSTK1 protein is 159.40-218.50 ng/ml.

Mammalian Cell Expression System

Introduction:

The prokaryotic expression system has the advantages of high expression level, simple operation, short cycle, easy large-scale and high-density culture and low cost. For the full-length antibody and glycoprotein biological drug, the folding of expression product polypeptide chain, the disulfide bond, the presence or absence of glycosylation and the type of glycosylation often affect the properties of the synthesis, secretion, biological activity, in vivo stability, and immunogenicity of the expressed product. Compared with other eukaryotic expression systems, the expression of the target gene in mammalian cells is similar to that of the native protein in the type and manner of the glycosylation, and can be correctly assembled into the multi-subunit protein.

Advantages:

  • No self-produced endotoxin
  • Secretion expression is available
  • With a variety of complex N-linked glycosylation, accurate O-linked glycosylation and other post-translational processing
  • Close to native protein in the molecular structure, physical and chemical properties and biological functions
  • High yield after system optimization: as high as 100 mg/L
  • Multi-cell lines, multi-expression methods to improve the protein expression success rate and protein yield
  • Price =  low, delivery time as short as 35 business days

Guarantee:

Risk-free: We do NOT charge if we cannot deliver the protein.

Note: This risk-free custom protein service is only suitable for proteins within 800aa. We will charge according to different steps if you need to express proteins more than 800aa.

Service Process:

Steps Project Process Cusabio Features Lead Time
1 Plasmid construction  Codon optimization; gene synthesis Multiple vectors optimization, More options for customers
In order to improve the success rate of expression and achieve higher yield, in addition to conventional N-terminal fusion protein expression, we also provide C-terminal fusion protein, which retains the bioactivity of the protein while ensuring high purity.
15-20 business days
The PCR amplification products are ligated to the vectors e.g. pSec series, pCMV series and pcDNA series vectors
Transform TOP10 E.coil competent cells
Obtain the correct recombinant plasmid
2 Small scale expression  Prepare the transfection grade recombinant plasmid in large quantities Optimization of transfection conditions
Set different transfection conditions, select the optimal experimental conditions according to the test results.
9-11 business days
Transient transfect HEK293, CHO and other cells
Detect expression products
3 Scale up expression and purification Scale up the culture cells and transfect Multi-condition expression scheme
According to the protein localization and the best experimental conditions in the small test expression, select different cell lines and different ways of transfection, which can increase the expression quantity, greatly improve the protein expression.
8-9 business days
Explore different chromatographic conditions including ion exchange, hydrophobic and others by using AKTA, and then determine the optimal purification method.
4 Additional services (Optional) Charge Tag removal by restriction digestion Flexible additional services
Customers can flexibly choose from a variety of additional services to their specific needs, e.g. Endotoxin removal, Filter-sterilization, Tag removal, Lyophilization, etc. Some are complimentary, and some require additional charge.
3 business days
Free Filter-sterilization; Endotoxin removal; Lyophilization (Note: Lyophilization and Filter-sterilization can not be met simultaneously) 2 business days
5 Quality Control Testing of purity, concentration, etc. QC report is provided. Detailed COA report
Detailed product data sheet and COA are provided for each project.
3-5 business days
Total lead time 35-45 business days

Project showcase

Case 1
It is well known that the expression yield of mammalian cells is relatively low, the protein was optimally expressed with our mammalian expression system, the target band can be observed by SDS-PAGE analysis of the culture supernatants. The purified protein expression level can up to 10 mg/L. The theoretical molecular weight of the protein was 42 kDa, and the protein is modified with glycosylation by SDS-PAGE, which was confirmed by the examination of LC-MS/MS.

  • Lane 1:Flow through
  • Lane 2:Culture medium stoste
  • Lane 3:Marker
  • Lane 4:20 mM imidazole elution
  • Lane 5:60 mM imidazole elution

Case 2
Three full-length antibodies were transfected into CHO cells using our vector, after SDS-PAGE detection, the bands were observed in the supernatant of the culture medium, the expressed level was up to 100 mg/L.

  • Lane 1:Antibody 1 culture medium stoste
  • Lane 2:Antibody 1 flow through
  • Lane 3:Antibody 1 elution
  • Lane 4:Antibody 2 culture medium stoste
  • Lane 6:Marker
  • Lane 7:Antibody 2 elution
  • Lane 8:Antibody 3 culture medium stoste
  • Lane 9:Antibody 3 flow through
  • Lane 10:Antibody 3 elution

Platform introduction

Characteristic expression systems

pSecTag2A-JT Vector+HEK293 Cell efficient expression

  1. Carrys CMV strong promoter, containing IgK signal peptide which can enhance the secretory quantity of the protein
  2. Compared with conventional 6xHis tag, the N-terminal 10xHis tag has a stronger binding ability in IMAC. Meanwhile the thrombin site makes it easy to remove the tag to obtain untagged protein.
  3. The C-terminal MYC-tag can be used for WB detection, and it has stronger sensitivity compared with His-tag.
  4. Amp resistance screening.

Insect Baculovirus Expression System

Introduction:

Insect baculovirus expression vector system (BEVS) belongs to the eukaryotic expression system, and it’s an expression system with high safety. It has a large genome, which enables the insertion of large exogenous genes, therefore has the great advantage of expressing proteins with large molecular weight. It also has the ability to achieve complete post-translational modification and efficiently express exogenous genes. The system consists of transfer vector, baculovirus vector and the host cell. The system uses one or more baculovirus super-strong promoters, and gets the recombinant virus after the exogenous target gene is inserted into the promoter. The highly efficient expression of the exogenous gene is achieved while the recombinant viruses replicate themselves in the insect cells. BEVS is widely used in virus vaccine development (such as the development of influenza virus vaccine and HPV vaccine), preparation of cell signaling proteins and cytokines, as well as kinase development, etc.

Advantages:

  • Large capacity: ability to carry large gene fragment; advantage in large protein expression
  • High safety: baculovirus has strict species specificity
  • High expression efficiency: the protein can be efficiently expressed in the late-stage infected cells
  • The post-translational modification of the expressed product is similar to that of mammalian cells, particularly the glycosylation; the protein is more likely to be bioactive
  • Baculovirus is easier to amplify and can produce recombinant proteins in large scale
  • Our unique bacmid based expression system has prominent features including low cost, large volume suspension transfection, high titer, shorten lead-time by 1-2 weeks compare to classic process cycle
  • Price = low, delivery time as short as 7 weeks, yield up to 100 mg/L

Guarantee:

Risk-free: We do NOT charge if we cannot deliver the protein.

Note: This risk-free custom protein service is only suitable for proteins within 800aa. We will charge according to different steps if you need to express proteins more than 800aa.

Service Process:

Steps Project Process Cusabio Features Lead Time
1 Plasmid construction  Codon optimization; gene synthesis Vector optimization
In order to improve the success rate of expression and achieve higher yield, we provide protein expression using C-terminal fusion tags in addition to conventional N-terminal tags, which retains the bioactivity of the protein while ensuring high purity.
15-20 business days
The PCR product is ligated to the expression vectors e.g. pFastbac1-KHM, pFastBac1-MBP, etc.
Transform TOP10 E.coil competent cells
Obtain the correct recombinant plasmid
2 Preparation of recombinant Bacmid and high titer virus  Transform DH10Bac cells to get recombinant Bacmid; PCR analysis; Isolate recombinant bacmid DNA Suspension transfection
Unique suspension transfection method greatly increases the protein expression level, and effectively shortens the experimental cycle.
12-15 business days
Transfect recombinant Bacmid DNA into insect cells to obtain baculovirus, and detect expression level by SDS-PAGE; Repeat the infection if necessary
3 Scale up expression and purification Infect insect cells with appropriate baculovirus Expression optimization
After optimization, the large amount of protein can be obtained by infecting host cells with low-passage virus.
5-10 business days
The target protein is purified by affinity chromatography, ion exchange, hydrophobic and molecular sieves.
4 Additional services (optional) Charge Tag removal by restriction digestion Flexible additional services
Customers can flexibly choose from a variety of additional services to their specific needs, e.g. Endotoxin removal, Filter-sterilization, Tag removal, Lyophilization, etc. Some are complimentary, and some require additional charge.
3 business days
Free Filter-sterilization; Endotoxin removal; Lyophilization (Note: Lyophilization and Filter-sterilization can’t be met simultaneously) 2 business days
5 Quality Control Testing of purity, concentration, etc. QC report is provided. Detailed COA report
Detailed product data sheet and COA are provided for each project.
3-5 business days
Total lead time 35-50 business days

Project showcase

Case 1
The protein was highly expressed in our company’s Insect baculovirus expression vector system. A clear band was observed from cell lysate by SDS-PAGE. The yield was up to 20 mg/L after purification.

  • Protein purification image
  • Lane 1: Flow through.
  • Lane 2: Cell lysate
  • Lane 3: Marker
  • Lane 4: 30 mM imidazole elution
  • Lane 5: 60 mM imidazole elution
  • Lane 6: 250 mM imidazole elution

Case 2
This target protein is relatively large. After gene synthesis, vector construction, bacmid construction, we finally produced the protein in sf9 cells. The yield reached to 5 mg/L, and the purity was 95%.

  • Protein purification image
  • Lane 1:60 mM imidazole elution

Case 3
The molecular weight of this target protein is relatively small, and it is quite difficult to express. We chose to use the pFastBac1-MBP vector to make the recombinant construct. After enzyme digestion and secondary purification, the purity of target protein reached 95%.

  • Protein purification image
  • Lane 1: Fusion protein before digestion
  • Lane 2: Fusion protein after digestion
  • Lane 3: Fusion protein after secondary purification

Platform introduction

Characteristic expression systems

pFastbac1-KHM vector + sf9 cells, highly efficient expression system

  1. Seamless cloning, no restriction enzyme needed.
  2. Compared with conventional 6xHis tag, the N-terminal 10xHis tag has a stronger binding ability in IMAC. The thrombin site makes it easy to remove the tag.
  3. The C-terminal MYC-tag can be used for WB detection, and it has stronger sensitivity compared to His-tag.
  4. Amp resistance screening.

pFastBac1-MBP vector+sf9 cell, highly efficient expression system

  1. This vector contains MBP fusion tag that has a strong ability to promote expression.
  2. It is a better system for small protein expression.
  3. Seamless cloning, no restriction enzyme needed.
  4. The TEV cleavage site makes it easy for tag removal.
  5. Amp resistance screening.

Yeast Expression System

Introduction:

Yeast protein expression system is a highly economical eukaryotic expression system that do both secretion expression and intracellular expression. The exogenous gene expressed by Yeast expression system has a certain post-translational processing capacity, the expressed exogenous protein has a certain degree of folding and glycosylation modification, it’s more stable than prokaryotic expressed proteins, particularly suitable for the expression of eukaryotic genes and preparation of functional proteins. Yeast secretion expression can secrete the expressed exogenous protein into the extracellular matrix, so that it is easy to obtain a high purity protein. Yeast expression system has many advantages which make its research and application more and more widely.

Advantages:

  • Cost-effective, high expression level: as high as 100 mg/L (Shake flask culture)
  • No self-produced endotoxin
  • Products have post-translational modifications: glycosylation, phosphorylation, acylation, etc., it is more likely to have biological activity
  • Products can be properly folded and efficient secretion
  • It is more stable than prokaryotic proteins, and it is particularly suitable for the expression and preparation of functional proteins such as tuberculosis proteins, defensin, interleukin and cytokines
  • Unique PickRight technology, thus can directly obtain high expression level strains without screening after transformation, the time compared to traditional screening reduced 5-10 business days
  • Price = low , delivery time as short as 35 business days

Guarantee:

Risk-free: We do NOT charge if we cannot deliver the protein.

Note: This risk-free custom protein service is only suitable for proteins within 800aa. We will charge according to different steps if you need to express proteins more than 800aa.

Service Process:

Steps Project Process Cusabio Features Lead Time
1 Expression vector construction Codon optimization; gene synthesis Multiple vectors optimization, More options for customers
In order to improve the success rate of expression and achieve higher yield, in addition to conventional N-terminal fusion protein expression, we also provide protein with C-terminal fusion label, in greater degree to ensure the activity while ensuring the purity.
15-20 business days
The PCR amplification products are ligated to the expression vectors e.g. pPic9k, pPic3.5k, pPiczαA, etc.
Transform ligation mixtures into E. coli strain
Obtain the correct recombinant plasmid
2 Transformation and strain identification Prepare the recombinant plasmid in large quantities High copy screening
Conduct multiple screening through unique screening markers of different vectors, and the highest expression level strain was gradually obtained.
PickRight Technology
The high expression level strain was obtained directly after transformation, and the time was shorten by 5-10 business days compared with the traditional screening. (Theoretically this technology is mainly recommended for the production of less than 5 mg/L protein expression)
10-13 business days
Linearization of recombinant plasmid
Transform to GS115, X33, KM71 and other hosts by electroporation
PCR analysis is recommended to verify successful transformants
Use geneticin G418, Zeocion and other antibiotics for multiple copies screening to obtain high copy
3 Small test, scale up expression and purification Small scale expression screening (20-40 strains) 7-12 business days/15-25 business days (Featured Purification)
Determine strain and optimize expression conditions
Scale up culture
Protein purification Multiple purification methods (optional)
Explore different chromatographic conditions including ion exchange, hydrophobic and others by using AKTA, and then determine the optimal purification method.
4 Additional services (Optional) Charge Tag removal service Flexible additional services
Customers can flexibly choose from a variety of additional services to their specific needs, e.g. Endotoxin removal, Filter-sterilization, Tag removal, Lyophilization, etc. Some are complimentary, and some require additional charge.
3 business days
Free Filter-sterilization; Endotoxin removal; Lyophilization
(Note: Lyophilization and filter-sterilization can not be met simultaneously)
2 business days
5 Quality Control Testing of purity, concentration, etc. QC report is provided. Detailed COA Report
Detailed product data sheet and COA are provided for each project.
3-5 business days
Total lead time 35-50 business days

Project showcase

Case 1 High Purity Protein
Difficulty: Yeast intracellular expression, many impurities can be observed in the lysate protein (lane 1), the target protein was not obvious, after the yeast system-specific chromatography system purification, less miscellaneous band was observed with SDS-PAGE detection, the purity reached more than 95% (lane 6-7).

  • Lane 1:Lysate
  • Lane 2:Marker
  • Lane 3:Flow through
  • Lane 4-7:Target protein by different gradient elution

  • Lane 1:Lysate
  • Lane 2:Flow through
  • Lane 3:Marker
  • Lane 4-7:Target protein by different gradient elution

Features: Yeast secretion expression, the expressed protein was directly secreted into the medium, basically no impurities, the purity is as high as 90% or more, the purification is mainly for removing pigment and other residues in the medium, leaving only the target protein in the appropriate buffer.

  • Lane 1:Culture medium supernatant
  • Lane 2:Marker
  • Lane 3:Flow through
  • Lane 4:The eluted target protein

Case 2: Large Molecule Weight Protein Expression
Difficulty: More than 700 amino acids, Mw: 81 kDa, we chose secretory vector for expression in order to get a higher purity, finally the protein was successful expressed and secreted into the culture medium.

  • Lane 1:Culture medium supernatant
  • Lane 2:Flow through
  • Lane 3:The eluted target protein
  • Lane 4:Marker

Case 3: Small Molecule Weight Protein Expression
Difficulty: 62 amino acids, Mw: 7 kDa, the molecular weight is very small, relatively difficult to concentrate and detect the protein. The expression, purification, collection were very successful from the SDS-PAGE detection result.

  • Lane 1:Culture medium supernatant
  • Lane 2:The eluted target protein
  • Lane 3:Marker

Difficulty: www 36 amino acids, Mw: 4 kDa, and this customer required to remove the tag, it’s rather difficult to remove the tag as the molecular weight itself is very small, but we have successfully remove the tag after a series processing, and WB detection result showed the target protein didn’t contain tag, so finally high-purity, low-molecular-weight and untagged protein was obtained.

Case 4: N-linked glycosylation modification (Yeast expression system unique characteristics)
Features: Close to the modification of native proteins, especially glycosylation in the Yeast expression system is particularly evident by SDS-PAGE detection, it showed diffuse band and a large molecular weight, after digested by Endo H, the band was shaped and the size is consistent with the theoretical value.

  • Lane 1:Purified target protein (N-linked glycosylated modification)
  • Lane 2:Protein digested by Endo H enzyme
  • Lane 3:Marker

Case 5: pPic9k-SUMO Vector
Unique SUMO tag fusion protein

  • Lane 1:Culture medium supernatant
  • Lane 2:Flow through
  • Lane 3:Marker
  • Lane 4:SUMO tag fusion protein

Platform introduction

Characteristic expression systems

pPic9k-JT Plasmid+GS115 strain efficient expression

  1. Carrys AOX1 strong promoter, containing alpha secreting factor which is able to do high efficient secretion expression
  2. Seamless cloning, no restriction enzyme needed
  3. Multiple linearization sites:SalⅠ, SacⅠ, BglⅡ
  4. Can do Amp and Kan double-resistant screening to select positive strains during the prokaryotic stage
  5. Can do His+ and G418 screening to select high expression level strains during the eukaryotic stage
  6. Modified cloning sites, its cloning is not limited by the potential endonuclease in the target gene
  7. The vector has his tag, thus making it easy for cloning and purification

pPic9k-SUMO Plasmid+GS115 strain efficient expression

  1. Carry AOX1 strong promoter, containing alpha secreting factor which is able to do high efficient secretion expression
  2. Contain SUMO fusion protein; possessing a strong ability to promote expression
  3. Seamless cloning, no restriction enzyme needed.
  4. Contain the EK cleavage site, can obtain untagged protein after enzyme digestion.
  5. Multiple linearization sites:SalⅠ, SacⅠ
  6. Can do Amp and Kan double-resistant screening to select positive strains during the prokaryotic stage
  7. Can do His+ and G418 screening to select high expression level strains during the eukaryotic stage
  8. Modified cloning sites, its cloning is not limited by the potential endonuclease in the target gene
  9. The vector has his tag, thus making it easy for cloning and purification

E. coli Expression System

Introduction:

The E. coli expression system is regarded as the most commonly used, economical, and classical expression system because of its simple structure, clear genetic background, high yield of target protein, and its short culture period. In recent decades, E. coli expression system has also been developed and improved continuously, and been used intensively by scientific researchers and industrial users for a large number of recombinant protein expression. The system is mainly used for antigen preparation, ligand preparation, and expression of cytokines and bacteria (Staphylococcus aureus, Escherichia coli, etc.) proteins.

CUSABIO has extensive experience and be very professional in E. coli protein expression and purification. We can solve various difficult problems during the protein expression and purification process. From 2007 to 2017, we have successfully developed more than 4000 recombinant proteins expressed in E. coli, which contain hundreds of active proteins with high purity.

Advantages:

  • Clear genetic background
  • Cost-effective, easy for large-scale production. Price = low 
  • Short lead time
  • Fast growth and high yield: as high as 200 mg/L
  • More options for vectors and tags, higher success rate: as high as 99.1%
  • Easy to optimize various conditions to achieve the best results

Guarantee:

Risk-free: We do NOT charge if we cannot deliver the protein.

Note: This risk-free custom protein service is only suitable for proteins within 800aa. We will charge according to different steps if you need to express proteins more than 800aa.

Service Process:

Steps Project Process Cusabio Features Lead Time
1 Plasmid construction Codon optimization; gene synthesis Multiple vectors optimization, More options for customers
Optimize multiple vectors at the same time; Select the vector that has the highest yield, which can shorten lead time;
15-20 business days
Restriction digestion of PCR products; Ligation to expression vector, e.g. Pcold-SUMO, pGEX-4T-1, pET22b-JT, etc.
Transform TOP10 E.coil competent cells
Obtain the correct recombinant plasmid
2 Transformation and strain screening Transform the recombinant plasmid to host cells, e.g. BL21 (DE3), Rosetta-gami B (DE3) pLysS, C41 cells, culture overnight at 37℃ Multi-conditions optimization, multi-hosts selection
In the small test, the temperature and IPTG are optimized to obtain the most suitable culture conditions. Multiple hosts are transformed at the same time to select the host bacteria with the highest yield.
5 business days
Select single colony for small-scale induced expression; Detect protein expression by SDS-PAGE; Preserve the best colony.
Optimize the expression conditions
3 Target protein expression and purification 1-10 L large-scale expression Multiple purification methods (optional)
Explore different chromatographic conditions including ion exchange, hydrophobic and others by using AKTA, and then determine the optimal purification method.
12-15 business days
Protein purification
4 Inclusion body renaturation Refolding if the target protein is inclusion body Diverse refolding methods
A variety of buffering conditions are used to quickly screen the best refolding buffer formula. Refolding protein with purity greater than 90% is obtained by dilution renaturation, dialysis renaturation, column chromatography renaturation and so on. Solubilization and refolding can be achieved for more than 95% of inclusion bodies.
5 Additional services (Optional) Charge Tag removal by restriction digestion Flexible additional services
Customers can flexibly choose from a variety of additional services to their specific needs, e.g. Endotoxin removal, Filter-sterilization, Tag removal, Lyophilization, etc. Some are complimentary, and some require additional charge.
3 business days
Free Filter-sterilization; Endotoxin removal; Lyophilization (Note: Lyophilization and Filter-sterilization can not be met simultaneously) 2 business days
6 Quality Control Testing of purity, concentration, etc. QC report is provided. Detailed COA report
Detailed product data sheet and COA are provided for each project.
3-5 business days
Total lead time 35-45 business days

Platform introduction

Characteristic expression systems

pET22b-JT plasmid + Rosetta-gami B (DE3) pLysS host bacteria Low temperature expression system

Vector characteristics:

  1. Carry a T7 strong promoter; Contain PelB signal peptide; Low temperature induced secretory expression, which is conducive to correct protein folding and enhance protein solubility.
  2. Seamless cloning, no restriction enzyme needed.
  3. Compared with conventional 6xHis tag, the N-terminal 10xHis tag has a stronger binding ability in IMAC. Meanwhile the thrombin site makes it easy to remove the tag.
  4. The C-terminal MYC-tag can be used for WB detection, and it has stronger sensitivity compared with His-tag.
  5. Amp resistance screening.

pCold-SUMO plasmid + Rosetta-gami B(DE3)pLysS host bacteria low temperature expression system

Vector characteristics:

  1. Carry cspA strong promoter; Contain SUMO fusion protein; possessing a strong ability to promote expression.
  2. Seamless cloning, no restriction enzyme needed.
  3. Compared with conventional 6xHis tag, the N-terminal 10xHis tag has a stronger binding ability in IMAC. Meanwhile the thrombin site makes it easy to remove the tag.
  4. The C-terminal MYC-tag can be used for WB detection, and it has stronger sensitivity compared with His-tag.
  5. Amp resistance screening.

Project showcase

Case 1
Characteristics: The protein is a fusion protein, and digested with PreScission protease overnight through the GST affinity chromatography column, subsequently with one-step purification to obtain protein without tag.

  • Lane 1:Cell lysate (Arrow indicates the target fusion protein)
  • Lane 2:Flow through
  • Lane 3:Protein digested by PreScission protease (Arrow indicates the target protein)
  • Lane 4:Remove impurity with PBS
  • Lane 5:GSH elution (Arrow indicates GST-tagged protein)
  • Lane 6:Concentrated target protein

Case 2
Characteristics: After expression, the target protein was purified by nickel column affinity chromatography. The purity reached 90%, and the yield reached 20 mg/L

  • Lane 1:Cell lysate
  • Lane 2:Flow through
  • Lane 3:30 mM imidazole elution
  • Lane 4:60 mM imidazole elution
  • Lane 5:200 mM imidazole elution
  • Lane 6:500 mM imidazole elution

Case 3
Characteristics: Multiple tag options can be provided for one protein.

N-terminal 6xHis-SUMO-tagged

  • Lane 1:60 mM imidazole elution and concentrate
  • Lane 2:200 mM imidazole elution and concentrate
  • Lane 3:500 mM imidazole elution and concentrate

N-terminal GST-tagged

  • Lane 1:Cell lysate
  • Lane 2:Flow through
  • Lane 3:GSH elution

Case 4
Characteristics:The recombinant protein is functional active.

The Binding Activity of aqpZ with ytfE

Activity :Measured by its binding ability in a functional ELISA. Immobilized aqpZ at 5 μg/ml can bind human ytfE, the EC50 of human ytfE protein is 197.90-259.70 μg/ml.

 

Why choose us?

  • Risk-free: Do not charge by steps. No protein, No charge
  • Competitive price
  • 39 kinds of tags meeting different demands
  • Secondary AKTA-SEC purification to ensure high purity
  • Ability to achieve large-scale protein production (10 mg, 50 mg, 100 mg, 200 mg available)
  • Post-purification services available: Desalting, aliquot, endotoxin removal, aseptic process and lyophilization
Note: This risk-free custom protein service is only suitable for proteins within 800aa.We will charge according to different steps if you need to express proteins more than 800aa.

Service process:

Final Deliverables:

Purified protein, the purity is more than 85%;
Standard COA report as well as datasheet, including tag information, molecule weight, electrophoretic parameters, protein expression quantity, concentration, purity, SDS-PAGE, etc.

Which expression system suits your experiment most ?

Expression SystemSystem BenefitsApplicationFeatures of Cusabio
In vitro E.coli Expression SystemSimple, take short time, high expression quantity, open and flexible, easy to express specific proteins, prepare protein complexes, parallel to synthesize a variety of different proteins, etc.Toxic proteins, membrane proteinsSmall amount expression conditions fumble, solve relative problems professionally, greatly reducing the experimental period, increase the expression quantity
E. coli Expression SystemHigh target gene expression quantity, low cost, simple culture conditions, product rapidly, strong scalability, simple conversion operation, easy to form disulfide bondProkaryotic proteins, simple eukaryotic proteinsExpression includes soluble protein, inclusion body, fusion proteins, etc., with wealthy experience and expertise, we can solve a variety of bottlenecks during the protein expression process
Yeast Expression SystemCost-effective, low-cost for amplifying medium, simple culture conditions, production rapidly, strong scalability, good choice for secretory protein or intracellular protein expression, secrete proteins efficiently and allow simple purification, extensive post-translational modifications, no endotoxinIndustrial strain improvement, amplificationThe combination of self-transformed efficient secretion vector and host can achieve the highest quality protein expression to the maximum extent; Patented Biobrick technology can be successfully used to the improvement and optimization of industrial strain
Insect baculovirus expression systemLarge gene capacity, high efficiency of exogenous gene expression, effective cell fold, moderate scalability, extensive post-translational modifications, glycosylation similar to mammalian cells, is relatively easy enzymatic deglycosylation, no endotoxinVirus vaccines, signal proteins, cytokines, kinases, etc.Adopt AcNPV-sf9 cells and high5 cells two expression systems, the selectivity of multiple expression systems, multiple hosts, multi-carrier greatly improve the success rate of protein expression
Mammalian Cell Expression SystemHigher expression levels, moderate scalability, cell suspension culture characteristic can do mass production, effective protein fold, suitable for protein secretion, full post-translational modifications, no endotoxinComplex higher eukaryotes proteinsAdopt the specific combined methods of mammalian cell expression vector and a variety of transfection, optimize expression conditions, improve transfection efficiency, greatly shorten the experimental period, significantly increase the expression quantity

One-stop service of gene, cloning, point mutations :

  • Our synthesis technology is not reliant on PCR
  • Many difficult gene synthesis methods
  • Codon optimization service for free
  • Competitive price

Fast: fastest five working days delivery for simple gene under 1Kb

Stable: complete project management, stable production process

Accurate: sequence is 100% correct; NanoDrop 2000c accurate determination of concentration and purity

Resolute: difficult gene, synthesis advantage

Final delivery :

2-4 μg high purity plasmid (the default vector pUC57), piercing bacteria, sequencing report, COA report, sqd files

Case :

{GGGTTA}42

Gene Synthesis case {GGGTTA}42

{GCTTCCCCCTG}10

Gene Synthesis case {GCTTCCCCCTG}10

{CAC}82

Gene Synthesis case {CAC}82

{GGTCCTCCGCCTCCTCCACCTC}6

Gene Synthesis case {GGTCCTCCGCCTCCTCCACCTC}6

Vector Construction Services :

ShRNA vector construction

RNA interference (RNAi) refers to the phenomenon that the evolution is high conserved, double-stranded RNA induces homologous mRNA specificity degradation. Cusabio provides you with efficient, fast shRNA vector construction service, and constructs the target sequence into the expression vector in the form of hairpin. It can transcribe continuously & efficiently and process to produce effector molecules, finally ensuring the interference efficiency on the great degree.

Advantages

Characteristics: After expression, the target protein was purified by nickel column affinity chromatography. The purity reached 90%, and the yield reached 20 mg/L

  • ShRNA vector construction, 100% pass the hairpin area, failed construction does not charge any fees;
  • For anthropogenic gene, Cusabio designs the target spot and ensures more than 70% interference efficiency;
  • DIY construction, we can design and countrcut the vector according to your special demand.

Your satisfaction is our final goal !

In addition, we also provide you with a variety of value cloning and expression vector construction services.

vector construction services

ShRNA vector cloning vector expression vector microRNA overexpression vector reporter genevector

Point Mutation Services :

We generally use PCR technology to do directional or random mutations for mutation sites on the basis of guaranteeing fidelity in original sequence, types including bases addition, deletion, mutations etc. It is the common research means of genetic evolution, protein engineering, enzyme engineering etc.

Advantages

  • Absolutely guarantee the fidelity in the area of gene without mutation and vector
  • All mutations within 24 bp for one step and we only charge the fees of one site
  • Normative, strict standards of quality controlling

Cusabio has international advanced high-throughput DNA synthesizer, professional staffs and mature method for synthesis and purification. We can provide you with high-quality, multi-species primer synthesis service timely. We can ensure you with top quality and fast delivery time.

Advantages :

  • Ultrafast rate for primer synthesis
  • Perfect online ordering system and after-sales service for primer synthesis
  • International advanced high-throughput DNA synthesizer
  • With a variety of purification methods such as OPC, RPC, DSL, PAGE, etc.

Services :

Simple Oligo Synthesis

Length Productivity Nmole Purification Method Delivery Time Format
<15 bp 1-2 OD 25-50 nmol DSL, RPC 3-5 working days Lyophilized powder
3-4 OD 50-100 nmol 3-5 working days
15-59 bp 1-4 OD 10-50 nmol 3-5 working days
5-8 OD 50-100 nmol 3-5 working days
>8 OD >100 nmol Inquiry
<15 bp 1-2 OD 50-100 nmol PAGE 3-5 working days Lyophilized powder
15-59 bp 1-2 OD 25-50 nmol 3-5 working days
3-4 OD 50-100 nmol 3-5 working days
5-8 OD 100-200 nmol 3-5 working days
>8 OD Inquiry Inquiry
15-59 bp 1-2 OD 25-50 nmol HPLC 3-5 working days Lyophilized powder
3-4 OD 50-100 nmol 3-5 working days
5-6 OD 100-200 nmol 3-5 working days
>8 OD Inquiry Inquiry

Long Oligo Synthesis

 

Length Productivity Nmole Purification Method Delivery Time Format
60-80 bp 1-4 OD 10-50 nmol DSL, RPC 3-5 working days Lyophilized powder
5-8 OD 50-100 nmol 3-5 working days
>8 OD >100 nmol Inquiry
60-80 bp 1-2 OD 25-50 nmol PAGE 3-5 working days Lyophilized powder
3-4 OD 50-100 nmol 3-5 working days
5-8 OD 100-200 nmol 3-5 working days
>8 OD Inquiry Inquiry
15-59 bp 1-2 OD 25-50 nmol HPLC 3-5 working days Lyophilized powder
3-4 OD 50-100 nmol 3-5 working days
>5 OD >100 nmol Inquiry

Modified Oligo Synthesis :

Common modification forms of primer include phosphorylation, biotin, high and new, internal amino modification, 5 ‘ amino modification, 3 ‘ amino modified, etc. They can be used for all kinds of nonradioactive immunity analysis, hybridization reaction.

Cusabio has powerful primer synthesis ability, we can quickly synthesize high quality common primers for you, and we can also provide many kinds modify group of modified primer synthesis service. Such as:

 

Modification Species Specifications Purification Method
minor base dI, dU PAGE
Phosphorthioate SPO3 PAGE
Phosphorylation 5’PO4, 3’PO4 HPLC
Amino Linkers 5’ or 3’ NH2 C3, 5’ NH2 C6, 3’ NH2 C7, 5’ NH2 C12, 5’ NH2 C6 dT, 3’ NH2 C6 dT HPLC
Thiolation 3’ SH C6, 5’ SH C6 HPLC
Biotin 5’ Biotin, 3’ Biotin, 5’ Biotin TEG, 3’ Biotin TEG, 5’ Dual Biotin, 5’ or Internal Biotin dT, 5’ PC Biotin HPLC
Digoxin 5’ or 3’ Digoxin HPLC
Fluorophores 5’ Cy3, 3’ Cy3, Internal Cy3, 5’ Cy5, 3’ Cy5, Internal Cy5, 5’ FAM, 3’ FAM, 5’ HEX, 5’ TET, 5’ 6-JOE, 3’ 6-JOE, 5’ Rox, 3’ Rox, 5’ TAMRA, 3’ TAMRA, Internal TAMRA HPLC
Quenchers 3’ DABCYL, 3’ BHQ 1, 3’ BHQ 2 HPLC
3’ TAMRA 5’ FAM-3’ TAMRA, 5’ HEX-3’ TAMRA, 5’ TET-3’ TAMRA,5’ JOE-3’ TAMRA HPLC
3’ DABCYL 5’ FAM-3’ DABCYL, 5’ HEX-3’ DABCYL, 5’ TET-3’ DABCYL, 5’ JOE-3’ DABCYL, 5’ TAMRA-3’ DABCYL HPLC
3’ BHQ1 5’ FAM-3’ BHQ1, 5’ HEX-3’ BHQ1, 5’ HEX-3’ BHQ1 HPLC
BHQ2 5’ ROX-3’ BHQ2 HPLC

RNA Synthesis :

Chemical synthesized RNA as an important research tool, is widely used in the research and application of gene function analysis, new types of treatment strategies development etc.

Cusabio is equipped with various kinds of full-automatic synthesizers, advanced purification equipment, and has rich experience in RNA synthesis, has a perfected set of RNA synthesis and purification technology, can provide RNA synthesis products with high quality, including: single-stranded RNA, double-stranded RNA, modified/tagged RNA, siRNA, miRNA, mimics, etc.

In order to ensure the high quality of RNA oligo, Cusabio synthesizes RNA through MALDI – TOF mass spectrometry identification (matrix – assisted laser desorption/ionization time – of – light) with strict QC standards, and analyzes the purity of RNA product by HPLC.

Advantages

  • Flexible and varied synthesis specifications: 1 OD, 2 OD, 4 OD, 8 OD, etc, we can also provide large scale customization
  • Primer synthesis expert team with more than 20 years of experience
  • High quality: ISO 9001 certification, comprehensive quality control report (HPLC/MS/CGE)
  • Competitive price

CUSABIO has been specialized in applying advanced phage display technologies for a wide range of service projects. With years of experience, we can offer high-quality phage display library construction and custom phage display library screening services to meet your various demands precisely. We are confident that our phage display technologies could allow you have new opportunities in immunotherapy, drug discovery, and functional genomics.

Introduction of Phage Display Technology

Phage display is the technology that inserts the DNA sequence of foreign protein or peptide into the appropriate position of phage coat protein structural gene, so that the exogenous gene can be expressed along with the expression of phage coat protein itself. Meanwhile, the foreign protein also can be shown in the surface of phage coat protein following the reassembly of phage. In short, a phage library expressing a wide diversity of peptides or proteins is used to select those binding the desired targets.

Classification of Phage Display Systems

Based on different phages, vectors or libraries, the phage display systems could be divided into various types, details as below.

Based on Different Phages M13, f1, fd
T7, T4, lamda
Different Phages of Phage Display Systems Different Phages of Phage Display Systems

 

Based on Different Vectors Viral Vector
Phagemid
Different Vectors of Phage Display Systems
Based on Different Libraries cDNA Library
Antibody Library
Protein Library
Random Peptide Library

What phage display services could CUSABIO offer to you?

CUSABIO could provide phage display technologies to customers that cover the broad scope of the technologies including key areas of library construction and screening as well as antibody modification and expression.

1. Phage Display Library Construction

The phage display library technology refers to the clone and expression for variable region genes of all antibodies from a certain animal in a plasmid or phage, then screen clones carrying specific antibody genes via different antigens, thereby, to obtain corresponding specific antibodies or peptides.

CUSABIO is committed to offering quality services of antibody library construction as well as peptide library construction to customers.

phage display library construction

CUSABIO Service Process of Phage Display Library Construction

No. Process Service Items Service Cycle
1 Separation of lymphocytes Obtain lymphocytes from peripheral blood, spleen or bone marrow. 1 week
2 RNA isolation and cDNA synthesis RNA extraction, then reverse transcription into cDNA.
3 Construction of recombinant plasmid With cDNA as the template, the antibody gene will be extended with degenerate primer, then inserted into the phage vector. 4 weeks
4 Electro transformation library construction Prepare TG1 infected cells, then transform E. coli by well-constructed recombinant plasmid. 2 weeks
5 Capacity and diversity detection for antibody library Detect antibody library capacity via colony counting, as well as detect antibody library diversity via sequencing.
6 Phage display antibody library preparation To package the antibody library via infecting M13K07 phage. 1 week
7 Phage display antibody library titer detection Infect phage via TG1, then detect antibody library titer via colony counting.
8 Delivery Shipment with ice bags. Depends on express

2. Phage Display Library Screening

CUSABIO is mainly engaged in offering quality and personalized services of antibody library screening as well as peptide library screening to meet customers’ various demands.

Phage display library screening

2.1 Antibody Library Screening

CUSABIO can construct antibody libraries as well as screen desired monoclonal antibodies with high specificity and affinity from a wide range of species, such as human, alpaca, mouse, rabbit, chicken, dog, bovine, and so on. Compared with the traditional hybridoma method, antibody phage display library has distinct advantages on selecting novel monoclonal antibodies and even the fully humanized antibody. Furthermore, the antibodies from phage library have following advantages.

  • Short production cycle, because recombinant antitbodies are generated in vitro, which needn’t a long process for animals immunization.
  • Direct screening of human antibodies.
  • Screening antibodies that recognize toxicity or autoantigens.
  • Obtaining antibody genes for further direct modification.

2.2 Peptide Library Screening

As we known, peptides are biological molecules, consisting of short sequences of amino acids, so peptides are easy to be synthesized, show low toxicity and high efficiency. Most importantly, if targeting receptors or molecules that are specially expressed on cancer cells would significantly enhance cancer therapeutic effect and reduce cancer-related mortality as well. Thus phage display technology on screening target peptides for developing cancer drugs absolutely can offer new opportunities for the treatment of many tumor diseases. We are confident the peptide library screening service from CUSABIO can provide more possibilities for your research.

CUSABIO Service Process of Phage Display Library Screening

No. Process Service Items Service Cycle
1 Quality control of antigen Antigen purity detection by SDS-PGAE. 1 week
2 Antibody library screening To obtain the positive clones that recognize antigen through 3-4 rounds of screening. 2 weeks
3 Antibody sequencing Sequencing for positive clones. 1 week
4 Quality control of antibody To express target antibodies in E. coli, then quality control via ELISA. 1 week
5 Delivery Shipment with ice bags. Depends on express

CUSABIO Features of Phage Display Human Native Antibody Library

No. Items Features
1 Samples PBMC from 1000 healthy people
2 Library capacity 10^11
3 Insert percentage 95%

3. Antibody Humanization & Affinity Maturation

Humanized antibodies are antibodies from non-human species whose protein sequences have been modified to increase their similarity to antibody variants produced naturally in human beings.

As for affinity maturation, which is the process to increase their affinity for a particular antigen via their B cells during the course of an immune response. With repeated processes of somatic hypermutation for B-cell receptors and subsequent clonal selection to the same antigen, a host will produce antibodies of successively greater affinities.

Antibody humanization has played a fundamental role in the remarkable progress of antibodies as therapeutic reagents. As we known, since the advent of hybridoma technology, most monoclonal antibodies derive from rodent, such as mouse, rat, rabbit, hamster, etc. But most rodent antibodies have been shown a limited use as therapeutic agents because of a short serum half-life as well as they can not trigger human effector functions. Furthermore, most rodent monoclonal antibodies could be recognized as foreign proteins by the patients’ immune systems, then resulting in a human anti-mouse antibody (HAMA) response. On the other hand, in some cases, the affinity of a certain antibody deriving from phage library may not be high enough for used as therapeutic agents, then affinity maturation is urgently required to preserve the epitope specificity and functional activity of the antibody as well as boost potency to the desired level. Thus antibody humanization & affinity muturation absolutely double strong alliance for the antibody therapeutic applications.

CUSABIO Service Process of Antibody Humanization

No. Process Service Items Service Cycle
1 Antibody sequencing & analyzing 1. Antibody sequencing report; 12-16 weeks
2 Mutation library construction & screening 2. Antibody sequence analysis report;
3 Antibody production & validation 3. 1-3 antibodies with best affinity;

CUSABIO Service Process of Affinity Maturation

No. Process Service Items Service Cycle
1 Antibody sequencing & analyzing
  1. Antibody sequencing report;
  2. Antibody sequence analysis report;
  3. 1-3 antibodies with best affinity;

 

18-22 weeks
2 Alanine scanning
3 Mutation library construction & screening
4 Antibody production & validation

 

Choice of 80,000 possible targets, or provide the antigen/protein name, uniport reference or immunogen sequence.

Service includes everything from gene synthesis to purified antibody

Minimum order of either10mg protein A/G purified antibody or 1mg of antigen affinity purified antibody

 

Deliverables

  • Purified recombinant rabbit polyclonal antibody to specified target with a guaranteed titer of over 1:64,000 confirmed by ELISA. Final concentration to be provided at the end of the process.
  • Western blot data for the immunogen protein (Not applicable for synthetic peptide nor endogenous samples)
  • Immunogen sequencing report
  • 200ug of the immunogen protein
  • Pre-immune serum
  • Optional Free HRP, FITC, or Biotin conjugation
  • Control tag secondary antibodies

Thousands of made-to-order proteins from uncommon species including Saccharomyces cerevisiae, Arabidopsis thaliana, Rattus norvegicus, Bos taurus and others.

With a choice of

  • Sizes 20ug, 100ug or 1mg
  • Expression systems including, bacteria, yeast, baculovirus or mammal.
  • Tags
  • Buffers (request you own)
  • Expression regions (fully customizable)

Exosome Research

What are exosomes? Extracellular vesicles (EVs) 30 – 200 nm in size were once thought to be natural cellular debris; Read More...

Necrosis

What is necrosis Necrosis is an acute and severe response leading to the premature death of cells consequently damaging nearby Read More...

Monoclonal Antibodies

At Stratech, we specialise in providing a comprehensive range of monoclonal antibodies (mAbs) for scientific research. We partner with state-of-the-art Read More...

Autophagy

What is Autophagy? Autophagy (namely self-eating) is a highly conserved process for disassembling intracellular excess and dysfunctional components such as Read More...

Apoptosis

What is Apoptosis Apoptosis is a form of programmed cell death that occurs in multicellular organisms and has multiple functions Read More...

WNT Pathways

What is the Wnt Pathway? The Wnt pathway is a highly conserved signally pathway regulated by a series of Wnt Read More...

Immune Response

Resources for the Study of the Immune Response to SARS-CoV-2 and Other Viruses When a virus infects a host it Read More...

COVID-19 Research Products (Proteins, Antibodies, ELISA and cDNA)

Contact usPlace an Order Below is a comprehensive list of all our COVID-19 research products broken down into main product Read More...

COVID-19 Detection Kits

Request Rapid Test KitTechnical SupportRequest qPCR Test KitPlace an OrderAntibody Rapid Test Kits The antibody test kits detect the presence Read More...

Cusabio COVID-19

Research Solutions for Coronavirus – Cusabio

Contact usPlace an OrderCusabio COVID-19 RUO Detection Kits (IgG/IgM and qPCR based) Supplier Code Name Test type Size Price Cusabio Read More...

Coronavirus

COVID-19 Diagnostics Detection Kits (IgG/IgM Rapid test kits and RT-PCR)Viral Nucleic Acid Extraction Kits & Sample stabilisationCOVID-19 Research Products (Proteins, Read More...

First for Antibodies

Stratech Scientific have been successful in a recent antibodies tender from the Southern Universities Purchasing Consortium. In the award criterion Read More…

FAQs for ELISA Kit

1. Storage: Please store unopened kit at 2-8 ℃ and use the kit before expiration date. For opened kit, which Read More…

FAQs of Recombinant Proteins

Q: 1. Why does protein need lyophilization? What influences do the lyophilization have on proteins? A: The proteins are very Read More…

Genetic Engineering – Master the Essentials

Overview In Molecular Biology, the ability to successfully manipulate DNA is essential.  Stratech offers cutting edge cloning systems, genome editing Read More…